Transcript: Human XM_024446564.1

PREDICTED: Homo sapiens ring finger protein 146 (RNF146), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF146 (81847)
Length:
4858
CDS:
1582..2658

Additional Resources:

NCBI RefSeq record:
XM_024446564.1
NBCI Gene record:
RNF146 (81847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295951 TGTGATGCTAATACCGTAAAC pLKO_005 2131 CDS 100% 10.800 15.120 N RNF146 n/a
2 TRCN0000033982 GCCAGTAGTGATAGTGAGGAT pLKO.1 2452 CDS 100% 2.640 2.112 N RNF146 n/a
3 TRCN0000033979 CCTGTGAGATGTTTGATATTA pLKO.1 3046 3UTR 100% 15.000 10.500 N RNF146 n/a
4 TRCN0000295948 GGTGAATATGCATGGTATTAT pLKO_005 1882 CDS 100% 15.000 10.500 N RNF146 n/a
5 TRCN0000295950 TGCACAGTAACTGAAGTTTAA pLKO_005 2638 CDS 100% 13.200 9.240 N RNF146 n/a
6 TRCN0000295949 TGGCATAAGACCATTACTAAA pLKO_005 3017 3UTR 100% 13.200 9.240 N RNF146 n/a
7 TRCN0000033980 GCAGGAAGATTAAGCGAGATA pLKO.1 2066 CDS 100% 4.950 3.465 N RNF146 n/a
8 TRCN0000033981 CCTGTTCTAATACTGCACCTT pLKO.1 1649 CDS 100% 2.640 1.848 N RNF146 n/a
9 TRCN0000298725 CCTGTTCTAATACTGCACCTT pLKO_005 1649 CDS 100% 2.640 1.848 N RNF146 n/a
10 TRCN0000033983 GCTCATTTACAACTCAGTGGA pLKO.1 2320 CDS 100% 2.640 1.848 N RNF146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04256 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04256 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478817 ATATCTCTCAGTCTGCGAATTCAA pLX_317 34.4% 100% 100% V5 n/a
Download CSV