Transcript: Human XM_017011139.2

PREDICTED: Homo sapiens copine 5 (CPNE5), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPNE5 (57699)
Length:
2005
CDS:
381..1949

Additional Resources:

NCBI RefSeq record:
XM_017011139.2
NBCI Gene record:
CPNE5 (57699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157659 GTCATCGACAACACGCTCAAT pLKO.1 135 5UTR 100% 4.950 6.930 N CPNE5 n/a
2 TRCN0000151165 GTCATGAAGAACACCCTAAAT pLKO.1 645 CDS 100% 13.200 10.560 N CPNE5 n/a
3 TRCN0000150992 CAACATCTATGAGGTGGTAAA pLKO.1 830 CDS 100% 10.800 7.560 N CPNE5 n/a
4 TRCN0000151674 GCAAGTTCATTGTGGATTACT pLKO.1 169 5UTR 100% 5.625 3.938 N CPNE5 n/a
5 TRCN0000151871 CCTGATTTATCCAAACACGAT pLKO.1 246 5UTR 100% 2.640 1.848 N CPNE5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12396 pDONR223 100% 52.2% 46.4% None (many diffs) n/a
2 ccsbBroad304_12396 pLX_304 0% 52.2% 46.4% V5 (many diffs) n/a
3 TRCN0000470806 GGGTAGCATGCGGCTCGGCCTCGC pLX_317 51.7% 52.2% 46.4% V5 (many diffs) n/a
Download CSV