Transcript: Human NM_001304526.2

Homo sapiens lysine rich coiled-coil 1 (KRCC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
KRCC1 (51315)
Length:
1746
CDS:
388..1167

Additional Resources:

NCBI RefSeq record:
NM_001304526.2
NBCI Gene record:
KRCC1 (51315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143774 GCGGTCTAAGCATAAGAGAAA pLKO.1 909 CDS 100% 4.950 6.930 N KRCC1 n/a
2 TRCN0000142824 CAAGCACTTCTCCTCAGATAA pLKO.1 798 CDS 100% 13.200 9.240 N KRCC1 n/a
3 TRCN0000343766 CAAGCACTTCTCCTCAGATAA pLKO_005 798 CDS 100% 13.200 9.240 N KRCC1 n/a
4 TRCN0000122575 CCTACCCAAGATCATGCAATA pLKO.1 596 CDS 100% 10.800 7.560 N KRCC1 n/a
5 TRCN0000144798 GACCAGTCTATTCTTGGATTT pLKO.1 1144 CDS 100% 10.800 7.560 N KRCC1 n/a
6 TRCN0000216463 GACCAGTCTATTCTTGGATTT pLKO.1 1144 CDS 100% 10.800 7.560 N Krcc1 n/a
7 TRCN0000343768 GACCAGTCTATTCTTGGATTT pLKO_005 1144 CDS 100% 10.800 7.560 N KRCC1 n/a
8 TRCN0000144361 CCTTTGCACAATCTGTTTCTT pLKO.1 1491 3UTR 100% 5.625 3.938 N KRCC1 n/a
9 TRCN0000343770 CCTTTGCACAATCTGTTTCTT pLKO_005 1491 3UTR 100% 5.625 3.938 N KRCC1 n/a
10 TRCN0000145111 GTGGAAATAGAAACCGTACAT pLKO.1 991 CDS 100% 4.950 3.465 N KRCC1 n/a
11 TRCN0000343767 GTGGAAATAGAAACCGTACAT pLKO_005 991 CDS 100% 4.950 3.465 N KRCC1 n/a
12 TRCN0000145370 GCTTAAGAATCGAAAGGAGAA pLKO.1 1026 CDS 100% 4.050 2.835 N KRCC1 n/a
13 TRCN0000122666 GACCTACCCAAGATCATGCAA pLKO.1 594 CDS 100% 3.000 2.100 N KRCC1 n/a
14 TRCN0000144251 CAAATTGCTTTGATGGTGGAA pLKO.1 1423 3UTR 100% 2.640 1.848 N KRCC1 n/a
15 TRCN0000140007 GAGACTAGACTCTCTGAGCTA pLKO.1 675 CDS 100% 2.640 1.848 N KRCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03281 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03281 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465290 CTCATCTTCGCTGTGGTCCTGTTG pLX_317 45.7% 100% 100% V5 n/a
Download CSV