Transcript: Human XR_002957945.1

PREDICTED: Homo sapiens ATP binding cassette subfamily A member 8 (ABCA8), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCA8 (10351)
Length:
9928
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957945.1
NBCI Gene record:
ABCA8 (10351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156204 CCAATCGGATTCCTGGCATAT pLKO.1 3223 3UTR 100% 10.800 15.120 N ABCA8 n/a
2 TRCN0000151989 CATGGGTCATAGTATCTGATA pLKO.1 9620 3UTR 100% 4.950 6.930 N ABCA8 n/a
3 TRCN0000419884 GGGCTACTTGGAATGGTTAAA pLKO_005 3145 3UTR 100% 13.200 10.560 N Abca8b n/a
4 TRCN0000152073 CAACAAACTTGGGCCTTATTA pLKO.1 199 3UTR 100% 15.000 10.500 N ABCA8 n/a
5 TRCN0000151222 GCCCAAGCTTTCTTCAAATTA pLKO.1 8946 3UTR 100% 15.000 10.500 N ABCA8 n/a
6 TRCN0000151246 GCACATCCATTAAGGTGATAA pLKO.1 4811 3UTR 100% 13.200 9.240 N ABCA8 n/a
7 TRCN0000152102 CCAGTTCTTATGGACATTGTT pLKO.1 3118 3UTR 100% 5.625 3.938 N ABCA8 n/a
8 TRCN0000152332 CCAAATTCTGTGTTCCTGTTT pLKO.1 9133 3UTR 100% 4.950 3.465 N ABCA8 n/a
9 TRCN0000155945 CCTGGGAACTTTCTCCTCATT pLKO.1 2846 3UTR 100% 4.950 3.465 N ABCA8 n/a
10 TRCN0000154306 CGAAGGCCAAATCACTGCAAT pLKO.1 1692 3UTR 100% 4.950 3.465 N ABCA8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11488 pDONR223 100% 8% None 1_171del;970_9928del n/a
2 ccsbBroad304_11488 pLX_304 0% 8% V5 1_171del;970_9928del n/a
3 TRCN0000469794 CCATCTGATCATCTAAGAGGGCTC pLX_317 42.9% 8% V5 1_171del;970_9928del n/a
Download CSV