Transcript: Human NM_145689.3

Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
APBB1 (322)
Length:
2658
CDS:
123..2249

Additional Resources:

NCBI RefSeq record:
NM_145689.3
NBCI Gene record:
APBB1 (322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083494 CCAGAAGTTCCAAGTCTATTA pLKO.1 1736 CDS 100% 13.200 9.240 N APBB1 n/a
2 TRCN0000083495 GCATGAGATCTGCTCTAAGAT pLKO.1 1601 CDS 100% 5.625 3.938 N APBB1 n/a
3 TRCN0000083496 CCTGCATGAGATCTGCTCTAA pLKO.1 1598 CDS 100% 4.950 3.465 N APBB1 n/a
4 TRCN0000083493 GTGATAACACTGGAGTGGTAA pLKO.1 2429 3UTR 100% 4.950 3.465 N APBB1 n/a
5 TRCN0000083497 CCAGAATCGCAATGTGACCTT pLKO.1 380 CDS 100% 2.640 1.848 N APBB1 n/a
6 TRCN0000375281 TGCTCAAGTGCCACGTGTTTC pLKO_005 1543 CDS 100% 10.800 6.480 N Apbb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00076 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00076 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479791 AAGTGCTCTTAAAATGCCCAGAAG pLX_317 19.9% 100% 100% V5 n/a
Download CSV