Transcript: Human NM_007347.5

Homo sapiens adaptor related protein complex 4 subunit epsilon 1 (AP4E1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
AP4E1 (23431)
Length:
6743
CDS:
97..3510

Additional Resources:

NCBI RefSeq record:
NM_007347.5
NBCI Gene record:
AP4E1 (23431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007347.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382113 GTAGATCAAGCTATAACTAAA pLKO_005 2317 CDS 100% 13.200 18.480 N AP4E1 n/a
2 TRCN0000147403 GTTCTACTCTTCCTGACTATT pLKO.1 3452 CDS 100% 13.200 18.480 N AP4E1 n/a
3 TRCN0000148874 CAGAGCACTAACCTAGTAGAA pLKO.1 523 CDS 100% 4.950 6.930 N AP4E1 n/a
4 TRCN0000276394 CAGAGCACTAACCTAGTAGAA pLKO_005 523 CDS 100% 4.950 6.930 N AP4E1 n/a
5 TRCN0000149437 GCTGAGAAATATGCTCCTGAT pLKO.1 1405 CDS 100% 4.050 5.670 N AP4E1 n/a
6 TRCN0000379843 GATGCTTCCTTTGGCTATATT pLKO_005 373 CDS 100% 15.000 12.000 N AP4E1 n/a
7 TRCN0000382453 GAAACTAAGACTCCATATTAT pLKO_005 3318 CDS 100% 15.000 10.500 N AP4E1 n/a
8 TRCN0000276393 TCTACTCTTCCTGACTATTTA pLKO_005 3454 CDS 100% 15.000 10.500 N AP4E1 n/a
9 TRCN0000276455 AGAGTATGTCATCGTCAATTT pLKO_005 1362 CDS 100% 13.200 9.240 N AP4E1 n/a
10 TRCN0000148615 CCTTACGAAGAGCTGAGTTAA pLKO.1 1001 CDS 100% 13.200 9.240 N AP4E1 n/a
11 TRCN0000148077 GCTAAGCTCTACAAGTTACTT pLKO.1 1699 CDS 100% 5.625 3.938 N AP4E1 n/a
12 TRCN0000276457 GCTAAGCTCTACAAGTTACTT pLKO_005 1699 CDS 100% 5.625 3.938 N AP4E1 n/a
13 TRCN0000148614 CCCTAACCTTTAACTCAGGAT pLKO.1 3682 3UTR 100% 2.640 1.848 N AP4E1 n/a
14 TRCN0000276392 CCCTAACCTTTAACTCAGGAT pLKO_005 3682 3UTR 100% 2.640 1.848 N AP4E1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5991 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5991 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007347.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02765 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02765 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467195 CCGACTGTACATGTTCGCCGCGTG pLX_317 10.8% 100% 100% V5 n/a
Download CSV