Transcript: Human XM_017019574.2

PREDICTED: Homo sapiens coiled-coil domain containing 91 (CCDC91), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC91 (55297)
Length:
2533
CDS:
305..1540

Additional Resources:

NCBI RefSeq record:
XM_017019574.2
NBCI Gene record:
CCDC91 (55297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330632 TAGCCTGTGGGAGTCTATTAT pLKO_005 1839 3UTR 100% 15.000 12.000 N CCDC91 n/a
2 TRCN0000127979 GAGTCCATCTTTCACCATCTT pLKO.1 330 CDS 100% 4.950 3.960 N CCDC91 n/a
3 TRCN0000330630 GAGTCCATCTTTCACCATCTT pLKO_005 330 CDS 100% 4.950 3.960 N CCDC91 n/a
4 TRCN0000129916 GTGGATGAATATAAGGCACTA pLKO.1 854 CDS 100% 4.050 2.835 N CCDC91 n/a
5 TRCN0000130663 CAACATCTCCTGCTATTCCTT pLKO.1 199 5UTR 100% 3.000 2.100 N CCDC91 n/a
6 TRCN0000330629 CAACATCTCCTGCTATTCCTT pLKO_005 199 5UTR 100% 3.000 2.100 N CCDC91 n/a
7 TRCN0000127916 CAGAGAATACACATGCAGCAA pLKO.1 426 CDS 100% 2.640 1.848 N CCDC91 n/a
8 TRCN0000130719 GAAGTGGTGAAACCCAAACAA pLKO.1 181 5UTR 100% 5.625 3.375 N CCDC91 n/a
9 TRCN0000130878 GAAGAGCAGAAACGAAGTGAA pLKO.1 1340 CDS 100% 4.950 2.970 N CCDC91 n/a
10 TRCN0000330631 GAAGAGCAGAAACGAAGTGAA pLKO_005 1340 CDS 100% 4.950 2.970 N CCDC91 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12202 pDONR223 100% 99.9% 99.7% None 850G>A n/a
2 ccsbBroad304_12202 pLX_304 0% 99.9% 99.7% V5 850G>A n/a
3 TRCN0000468309 GTAGCAAATGTGTTGCAGGTCGTT pLX_317 36.6% 99.9% 99.7% V5 850G>A n/a
Download CSV