Transcript: Human NM_019009.4

Homo sapiens toll interacting protein (TOLLIP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
TOLLIP (54472)
Length:
3627
CDS:
135..959

Additional Resources:

NCBI RefSeq record:
NM_019009.4
NBCI Gene record:
TOLLIP (54472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019009.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314643 CACACAATGGCGCCAAGAATC pLKO_005 406 CDS 100% 10.800 15.120 N TOLLIP n/a
2 TRCN0000356024 TCGAGATCTTCGATGAGAGAG pLKO_005 484 CDS 100% 4.050 5.670 N TOLLIP n/a
3 TRCN0000063696 CGACTGAACATCACGGTGGTA pLKO.1 294 CDS 100% 2.640 2.112 N TOLLIP n/a
4 TRCN0000314642 GGCAAAGTTGGCCAAGAATTA pLKO_005 317 CDS 100% 13.200 9.240 N TOLLIP n/a
5 TRCN0000314717 CCAACAAGATTCCCGTGAAAG pLKO_005 1033 3UTR 100% 10.800 7.560 N TOLLIP n/a
6 TRCN0000314718 ACGACAAGGAGGGCATGATCA pLKO_005 613 CDS 100% 4.950 3.465 N TOLLIP n/a
7 TRCN0000063693 CCGTGATATTAACAACTCTAA pLKO.1 2608 3UTR 100% 4.950 3.465 N TOLLIP n/a
8 TRCN0000063697 GAAAGCCATCCAGGACATGTT pLKO.1 836 CDS 100% 4.950 3.465 N TOLLIP n/a
9 TRCN0000314641 GAACAAGGATGCCGCCATCAA pLKO_005 908 CDS 100% 4.950 3.465 N TOLLIP n/a
10 TRCN0000356025 GGTCCTGATGCCAACAGTGTA pLKO_005 692 CDS 100% 4.950 3.465 N TOLLIP n/a
11 TRCN0000356013 TTCTCCATGGACGACCGCATT pLKO_005 507 CDS 100% 4.050 2.835 N TOLLIP n/a
12 TRCN0000356023 CCGCTGGAATAAGGTCATCCA pLKO_005 428 CDS 100% 2.640 1.848 N TOLLIP n/a
13 TRCN0000063694 CGTGGACTCTTTCTATCTCGA pLKO.1 467 CDS 100% 2.640 1.848 N TOLLIP n/a
14 TRCN0000063695 GCTGGAATAAGGTCATCCACT pLKO.1 430 CDS 100% 2.640 1.848 N TOLLIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019009.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03420 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03420 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466589 GATTTGCACCTTAGACAGGGGGTC pLX_317 28.7% 100% 100% V5 n/a
4 ccsbBroadEn_08382 pDONR223 100% 99.8% 100% None 417G>A n/a
5 ccsbBroad304_08382 pLX_304 0% 99.8% 100% V5 417G>A n/a
6 TRCN0000479669 GATAAACAAGTCATTGATCTGGAA pLX_317 38% 99.8% 100% V5 417G>A n/a
Download CSV