Transcript: Human NM_003358.3

Homo sapiens UDP-glucose ceramide glucosyltransferase (UGCG), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
UGCG (7357)
Length:
3959
CDS:
403..1587

Additional Resources:

NCBI RefSeq record:
NM_003358.3
NBCI Gene record:
UGCG (7357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003358.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036128 CCGCGAATCCATGACAATATA pLKO.1 1467 CDS 100% 15.000 21.000 N UGCG n/a
2 TRCN0000300623 CCGCGAATCCATGACAATATA pLKO_005 1467 CDS 100% 15.000 21.000 N UGCG n/a
3 TRCN0000310810 GTGGACCAAACTACGAATTAA pLKO_005 1227 CDS 100% 15.000 21.000 N UGCG n/a
4 TRCN0000304108 GCATTATGGGACCCAACTATA pLKO_005 1501 CDS 100% 13.200 18.480 N UGCG n/a
5 TRCN0000370044 TCACATCCAAGATACTATATC pLKO_005 976 CDS 100% 13.200 18.480 N UGCG n/a
6 TRCN0000036127 GCTCAGTACATTGCCGAAGAT pLKO.1 1090 CDS 100% 4.950 6.930 N UGCG n/a
7 TRCN0000300622 GCTCAGTACATTGCCGAAGAT pLKO_005 1090 CDS 100% 4.950 6.930 N UGCG n/a
8 TRCN0000036124 GCCACCTTAGAGCAGGTATAT pLKO.1 946 CDS 100% 13.200 9.240 N UGCG n/a
9 TRCN0000036125 GCTATCATCTACACCCGATTA pLKO.1 487 CDS 100% 10.800 7.560 N UGCG n/a
10 TRCN0000036126 GCAGAGGAAATCCTAGATGTA pLKO.1 1564 CDS 100% 4.950 3.465 N UGCG n/a
11 TRCN0000093766 GCCATTGATGTATGTAAGAAA pLKO.1 682 CDS 100% 5.625 3.938 N Ugcg n/a
12 TRCN0000316732 GCCATTGATGTATGTAAGAAA pLKO_005 682 CDS 100% 5.625 3.938 N Ugcg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003358.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07117 pDONR223 100% 99.8% 100% None 15C>T;459G>A n/a
2 ccsbBroad304_07117 pLX_304 0% 99.8% 100% V5 15C>T;459G>A n/a
3 TRCN0000479529 TAATACGATTACTCACTCCCTCCT pLX_317 23.6% 99.8% 100% V5 15C>T;459G>A n/a
Download CSV