Transcript: Human XM_017005749.2

PREDICTED: Homo sapiens xyloside xylosyltransferase 1 (XXYLT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XXYLT1 (152002)
Length:
2217
CDS:
77..865

Additional Resources:

NCBI RefSeq record:
XM_017005749.2
NBCI Gene record:
XXYLT1 (152002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158293 CGAGGTGCTTAACCTTCACTT pLKO.1 478 CDS 100% 4.950 6.930 N XXYLT1 n/a
2 TRCN0000152157 CCTGAAGTTTAAGACCAACAT pLKO.1 760 CDS 100% 4.950 3.465 N XXYLT1 n/a
3 TRCN0000152494 CTTCAAGTGCAAGGTCATCTT pLKO.1 568 CDS 100% 4.950 3.465 N XXYLT1 n/a
4 TRCN0000094003 CCTGCTGATGATGTTCACCAA pLKO.1 376 CDS 100% 2.640 1.848 N Xxylt1 n/a
5 TRCN0000156328 CCTGCTGATGATGTTCACCAA pLKO.1 376 CDS 100% 2.640 1.848 N XXYLT1 n/a
6 TRCN0000156813 GAACCTACTACAGTGACTCCA pLKO.1 666 CDS 100% 2.640 1.848 N XXYLT1 n/a
7 TRCN0000153291 GAATTTGACAGTTTCCTGCCA pLKO.1 797 CDS 100% 0.660 0.462 N XXYLT1 n/a
8 TRCN0000158323 CTTGGGAACCTACTACAGTGA pLKO.1 661 CDS 100% 2.640 1.584 N XXYLT1 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2176 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2176 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2174 3UTR 100% 4.950 2.475 Y ERN2 n/a
12 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2174 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2174 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13283 pDONR223 100% 63.3% 63.3% None 1_39del;786_787ins393 n/a
2 ccsbBroad304_13283 pLX_304 0% 63.3% 63.3% V5 1_39del;786_787ins393 n/a
3 TRCN0000477318 CCGTACAGCATCACTATAATTTTG pLX_317 34.2% 63.3% 63.3% V5 1_39del;786_787ins393 n/a
Download CSV