Transcript: Human XM_005269286.5

PREDICTED: Homo sapiens xyloside xylosyltransferase 1 (XXYLT1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XXYLT1 (152002)
Length:
6420
CDS:
3055..3675

Additional Resources:

NCBI RefSeq record:
XM_005269286.5
NBCI Gene record:
XXYLT1 (152002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269286.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156726 GCAGGGAAGTCCTGTGATTAA pLKO.1 3777 3UTR 100% 13.200 9.240 N XXYLT1 n/a
2 TRCN0000158040 CCAGGACTTCTTCACCATGAT pLKO.1 3483 CDS 100% 4.950 3.465 N XXYLT1 n/a
3 TRCN0000152157 CCTGAAGTTTAAGACCAACAT pLKO.1 3177 CDS 100% 4.950 3.465 N XXYLT1 n/a
4 TRCN0000156626 GCCAGTTTACAGGCACACATT pLKO.1 3267 CDS 100% 4.950 3.465 N XXYLT1 n/a
5 TRCN0000157202 GCTTGTATCTCCCAGCTACAT pLKO.1 4334 3UTR 100% 4.950 3.465 N XXYLT1 n/a
6 TRCN0000156813 GAACCTACTACAGTGACTCCA pLKO.1 3083 CDS 100% 2.640 1.848 N XXYLT1 n/a
7 TRCN0000157398 GCAATTCCCAAGTGTGACCAT pLKO.1 4821 3UTR 100% 2.640 1.848 N XXYLT1 n/a
8 TRCN0000153291 GAATTTGACAGTTTCCTGCCA pLKO.1 3214 CDS 100% 0.660 0.462 N XXYLT1 n/a
9 TRCN0000158323 CTTGGGAACCTACTACAGTGA pLKO.1 3078 CDS 100% 2.640 1.584 N XXYLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269286.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13283 pDONR223 100% 54.2% 54.2% None 0_1ins522 n/a
2 ccsbBroad304_13283 pLX_304 0% 54.2% 54.2% V5 0_1ins522 n/a
3 TRCN0000477318 CCGTACAGCATCACTATAATTTTG pLX_317 34.2% 54.2% 54.2% V5 0_1ins522 n/a
Download CSV