Transcript: Human NM_024833.3

Homo sapiens zinc finger protein 671 (ZNF671), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF671 (79891)
Length:
2431
CDS:
97..1701

Additional Resources:

NCBI RefSeq record:
NM_024833.3
NBCI Gene record:
ZNF671 (79891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024833.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218897 GCAGTAAGTCTAATCTCATTC pLKO_005 1232 CDS 100% 10.800 15.120 N ZNF671 n/a
2 TRCN0000231088 TACCTTACACCTGGCTAAATA pLKO_005 621 CDS 100% 0.000 0.000 N ZNF671 n/a
3 TRCN0000231090 CATACTGCGTTTACCATTTAC pLKO_005 2109 3UTR 100% 13.200 10.560 N ZNF671 n/a
4 TRCN0000019516 GCAGTGATTATGAGTGTAGCA pLKO.1 1439 CDS 100% 2.640 2.112 N ZNF671 n/a
5 TRCN0000019514 GCCAAAGCTATGACCTCTTTA pLKO.1 1064 CDS 100% 13.200 9.240 N ZNF671 n/a
6 TRCN0000231089 ACACGGGTGAAAGACTCTATC pLKO_005 1184 CDS 100% 10.800 7.560 N ZNF671 n/a
7 TRCN0000231087 GATCACGTGCAGTCATGAAAC pLKO_005 377 CDS 100% 10.800 7.560 N ZNF671 n/a
8 TRCN0000019517 GCTTGTGAGTGGCTTTCTCAT pLKO.1 915 CDS 100% 4.950 3.465 N ZNF671 n/a
9 TRCN0000019515 CCCAATATTGAAAGATACCTT pLKO.1 606 CDS 100% 3.000 2.100 N ZNF671 n/a
10 TRCN0000019518 CGGGAAGAATGGGAGCTTCTT pLKO.1 274 CDS 100% 0.495 0.347 N ZNF671 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024833.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14274 pDONR223 100% 96% 96% None 1602_1603ins66 n/a
2 ccsbBroad304_14274 pLX_304 0% 96% 96% V5 1602_1603ins66 n/a
3 TRCN0000468184 AATTTTAGCAAGCCTGGTGATATC pLX_317 10.3% 96% 96% V5 1602_1603ins66 n/a
Download CSV