Transcript: Human NM_001200049.3

Homo sapiens cilia and flagella associated protein 46 (CFAP46), mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
CFAP46 (54777)
Length:
8263
CDS:
87..8234

Additional Resources:

NCBI RefSeq record:
NM_001200049.3
NBCI Gene record:
CFAP46 (54777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001200049.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263918 CTGAGGTTGCCGATAAGATAG pLKO_005 7048 CDS 100% 10.800 15.120 N CFAP46 n/a
2 TRCN0000172324 CCTGAGGTTGCCGATAAGATA pLKO.1 7047 CDS 100% 5.625 7.875 N CFAP46 n/a
3 TRCN0000129964 GACGAACTTCAGTTAAAGGAA pLKO.1 765 CDS 100% 3.000 4.200 N CFAP46 n/a
4 TRCN0000128753 CCAGCCTTTCCCAAATCATAA pLKO.1 547 CDS 100% 13.200 10.560 N CFAP46 n/a
5 TRCN0000282857 GTTCGATGAAGGGACAATTTC pLKO_005 7121 CDS 100% 13.200 10.560 N CFAP46 n/a
6 TRCN0000263917 AGAGCTTCCTGTCCCATATAT pLKO_005 7534 CDS 100% 15.000 10.500 N CFAP46 n/a
7 TRCN0000282855 TGTGGAATCGCCTCCATAAAG pLKO_005 7174 CDS 100% 13.200 9.240 N CFAP46 n/a
8 TRCN0000129323 CAAAGGAGAACCGAGGTACTA pLKO.1 443 CDS 100% 4.950 3.465 N CFAP46 n/a
9 TRCN0000129216 CCTACAGACACTTAGGTCATT pLKO.1 895 CDS 100% 4.950 3.465 N CFAP46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001200049.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13467 pDONR223 100% 8.8% 8.3% None (many diffs) n/a
2 ccsbBroad304_13467 pLX_304 0% 8.8% 8.3% V5 (many diffs) n/a
3 TRCN0000468327 ATAATACACCTAGCCTCTTATCGA pLX_317 61.1% 8.8% 8.3% V5 (many diffs) n/a
Download CSV