Transcript: Human NM_001042610.3

Homo sapiens dysbindin domain containing 1 (DBNDD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
DBNDD1 (79007)
Length:
2056
CDS:
116..592

Additional Resources:

NCBI RefSeq record:
NM_001042610.3
NBCI Gene record:
DBNDD1 (79007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072735 CGAGGTCTTTGCTGACTCGGA pLKO.1 382 CDS 100% 0.220 0.176 N DBNDD1 n/a
2 TRCN0000072733 GCTTTCTCTTTCAGTCCCATA pLKO.1 1905 3UTR 100% 4.050 2.835 N DBNDD1 n/a
3 TRCN0000072734 ACACGTTTCTCACTGTGGAGA pLKO.1 555 CDS 100% 2.640 1.848 N DBNDD1 n/a
4 TRCN0000417771 GAACGTGCTGAGGAATGGAGT pLKO_005 932 3UTR 100% 2.640 1.848 N DBNDD1 n/a
5 TRCN0000072736 GATCGTTAAGGAGGCTGAGGT pLKO.1 148 CDS 100% 2.640 1.848 N DBNDD1 n/a
6 TRCN0000072737 GACGAGGACAAGGGCTGAGCA pLKO.1 481 CDS 100% 0.000 0.000 N DBNDD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04021 pDONR223 100% 86% 81.5% None (many diffs) n/a
2 ccsbBroad304_04021 pLX_304 0% 86% 81.5% V5 (many diffs) n/a
3 TRCN0000480234 GATTTAAGACGACCCAGCCATTGG pLX_317 55.2% 86% 81.5% V5 (many diffs) n/a
Download CSV