Transcript: Human NM_001322970.2

Homo sapiens ornithine aminotransferase (OAT), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
OAT (4942)
Length:
2342
CDS:
384..1703

Additional Resources:

NCBI RefSeq record:
NM_001322970.2
NBCI Gene record:
OAT (4942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034850 GCTTCGAGAGTCCATTGAAAT pLKO.1 1655 CDS 100% 13.200 18.480 N OAT n/a
2 TRCN0000034853 CGACTTCGAGATAATGGACTT pLKO.1 1569 CDS 100% 4.050 5.670 N OAT n/a
3 TRCN0000034849 CCCAACCAGTTACGATGGTTT pLKO.1 953 CDS 100% 0.495 0.693 N OAT n/a
4 TRCN0000034852 GCTACATCTGTTGCAACTAAA pLKO.1 456 CDS 100% 13.200 10.560 N OAT n/a
5 TRCN0000034851 GTTCTCTTTATTGCTGATGAA pLKO.1 1155 CDS 100% 4.950 3.465 N OAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15514 pDONR223 0% 99.9% 100% None 1134C>T n/a
2 ccsbBroad304_15514 pLX_304 0% 99.9% 100% V5 1134C>T n/a
3 TRCN0000472176 AGTCCCTCATAACCATTTATAACC pLX_317 35.3% 99.9% 100% V5 1134C>T n/a
4 ccsbBroadEn_06665 pDONR223 100% 99.8% 100% None 15A>G;1311G>A n/a
5 ccsbBroad304_06665 pLX_304 0% 99.8% 100% V5 15A>G;1311G>A n/a
6 TRCN0000473531 GATCACCGAGTCTTGAAACCCTTA pLX_317 34.8% 99.8% 100% V5 15A>G;1311G>A n/a
Download CSV