Transcript: Human NM_004034.4

Homo sapiens annexin A7 (ANXA7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ANXA7 (310)
Length:
2509
CDS:
49..1515

Additional Resources:

NCBI RefSeq record:
NM_004034.4
NBCI Gene record:
ANXA7 (310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004034.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303433 CTTCATGCCTCCTACGTATTA pLKO_005 810 CDS 100% 13.200 18.480 N ANXA7 n/a
2 TRCN0000382407 GAGACTAGGGACCGATGAATC pLKO_005 1113 CDS 100% 10.800 15.120 N ANXA7 n/a
3 TRCN0000056307 CCGAAGACTTCTTCTGGCTAT pLKO.1 1482 CDS 100% 4.050 5.670 N ANXA7 n/a
4 TRCN0000056306 CCGGATATGTAGAAAGTGGTT pLKO.1 1247 CDS 100% 2.640 3.696 N ANXA7 n/a
5 TRCN0000056305 CGAGAAATTGTCAGATGTTAT pLKO.1 925 CDS 100% 13.200 10.560 N ANXA7 n/a
6 TRCN0000299173 CGAGAAATTGTCAGATGTTAT pLKO_005 925 CDS 100% 13.200 10.560 N ANXA7 n/a
7 TRCN0000380208 AGGAACTCAGGAACGTGTATT pLKO_005 867 CDS 100% 13.200 9.240 N ANXA7 n/a
8 TRCN0000380323 GAGCTACCATGGAGGCTTATT pLKO_005 1178 CDS 100% 13.200 9.240 N ANXA7 n/a
9 TRCN0000303432 TCTAATCAAGATGTCAAATTG pLKO_005 1785 3UTR 100% 13.200 9.240 N ANXA7 n/a
10 TRCN0000056303 CCAGAGTATAAACCACCAAAT pLKO.1 1050 CDS 100% 10.800 7.560 N ANXA7 n/a
11 TRCN0000299172 CCAGAGTATAAACCACCAAAT pLKO_005 1050 CDS 100% 10.800 7.560 N ANXA7 n/a
12 TRCN0000056304 GCTGCCAACTTCGATGCTATA pLKO.1 592 CDS 100% 10.800 7.560 N ANXA7 n/a
13 TRCN0000310376 GCTGCCAACTTCGATGCTATA pLKO_005 592 CDS 100% 10.800 7.560 N ANXA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004034.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00072 pDONR223 100% 95.4% 95.4% None 436_501del n/a
2 ccsbBroad304_00072 pLX_304 0% 95.4% 95.4% V5 436_501del n/a
3 TRCN0000467745 GCCGATACAAATAATCCAATAGTT pLX_317 24.9% 95.4% 95.4% V5 436_501del n/a
Download CSV