Transcript: Human NM_001190484.3

Homo sapiens cytochrome P450 family 3 subfamily A member 5 (CYP3A5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
CYP3A5 (1577)
Length:
4473
CDS:
101..523

Additional Resources:

NCBI RefSeq record:
NM_001190484.3
NBCI Gene record:
CYP3A5 (1577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064237 CGTCAGGGTCTCTGGAAATTT pLKO.1 260 CDS 100% 15.000 10.500 N CYP3A5 n/a
2 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1160 3UTR 100% 4.950 2.475 Y KAAG1 n/a
3 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 1164 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00412 pDONR223 100% 25.1% 22.3% None (many diffs) n/a
2 ccsbBroad304_00412 pLX_304 0% 25.1% 22.3% V5 (many diffs) n/a
3 TRCN0000468230 ATCAACTGGCCTGCGCCACCCCTT pLX_317 31.3% 25.1% 22.3% V5 (many diffs) n/a
Download CSV