Transcript: Human NM_001134492.2

Homo sapiens heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
HS2ST1 (9653)
Length:
1598
CDS:
403..1092

Additional Resources:

NCBI RefSeq record:
NM_001134492.2
NBCI Gene record:
HS2ST1 (9653)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424455 ATGTCATAAGGGATCCTATTG pLKO_005 884 CDS 100% 10.800 8.640 N HS2ST1 n/a
2 TRCN0000034937 CTTCATATCAACACTACCAAA pLKO.1 715 CDS 100% 4.950 3.465 N HS2ST1 n/a
3 TRCN0000034934 CGAGAAATTGAGCAGCGACAT pLKO.1 553 CDS 100% 4.050 2.835 N HS2ST1 n/a
4 TRCN0000034938 GACACGTTTCTTACTTGGATT pLKO.1 824 CDS 100% 4.950 2.970 N HS2ST1 n/a
5 TRCN0000313414 GTGAAGAAGAAACCAATTTAT pLKO_005 859 CDS 100% 15.000 10.500 N Hs2st1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02221 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02221 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474800 AGGAAACTTGTAGACTTAGAAACG pLX_317 72.2% 100% 100% V5 n/a
Download CSV