Transcript: Human NM_001370663.1

Homo sapiens cullin 1 (CUL1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CUL1 (8454)
Length:
3088
CDS:
230..2560

Additional Resources:

NCBI RefSeq record:
NM_001370663.1
NBCI Gene record:
CUL1 (8454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003391 GCACACAAGATGAATTAGCAA pLKO.1 1074 CDS 100% 3.000 4.200 N CUL1 n/a
2 TRCN0000318413 GCACACAAGATGAATTAGCAA pLKO_005 1074 CDS 100% 3.000 4.200 N CUL1 n/a
3 TRCN0000003393 GCCAGCATGATCTCCAAGTTA pLKO.1 1685 CDS 100% 5.625 3.938 N CUL1 n/a
4 TRCN0000318414 GCCAGCATGATCTCCAAGTTA pLKO_005 1685 CDS 100% 5.625 3.938 N CUL1 n/a
5 TRCN0000010781 CCCGCAGCAAATAGTTCATGT pLKO.1 2588 3UTR 100% 4.950 3.465 N CUL1 n/a
6 TRCN0000318416 CCCGCAGCAAATAGTTCATGT pLKO_005 2588 3UTR 100% 4.950 3.465 N CUL1 n/a
7 TRCN0000003392 CGTGGTTATATCAGTTGTCTA pLKO.1 1968 CDS 100% 4.950 3.465 N CUL1 n/a
8 TRCN0000318415 CGTGGTTATATCAGTTGTCTA pLKO_005 1968 CDS 100% 4.950 3.465 N CUL1 n/a
9 TRCN0000003394 GATTTGATGGATGAGAGTGTA pLKO.1 554 CDS 100% 4.950 3.465 N CUL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11274 pDONR223 100% 56.5% 55.1% None (many diffs) n/a
2 ccsbBroad304_11274 pLX_304 0% 56.5% 55.1% V5 (many diffs) n/a
3 TRCN0000478962 CTCATCCCATCGAATTCGTTCCTG pLX_317 27.5% 56.5% 55.1% V5 (many diffs) n/a
Download CSV