Transcript: Human NM_001351001.2

Homo sapiens zinc finger protein 789 (ZNF789), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
ZNF789 (285989)
Length:
2911
CDS:
222..413

Additional Resources:

NCBI RefSeq record:
NM_001351001.2
NBCI Gene record:
ZNF789 (285989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 648 3UTR 100% 4.950 2.475 Y CFLAR n/a
2 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 648 3UTR 100% 4.950 2.475 Y C19orf31 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2299 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 646 3UTR 100% 4.950 2.475 Y ERN2 n/a
5 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 646 3UTR 100% 4.950 2.475 Y P3H4 n/a
6 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 646 3UTR 100% 4.950 2.475 Y P3H4 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2299 3UTR 100% 5.625 2.813 Y EID2B n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 814 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09988 pDONR223 100% 13.8% 12.7% None (many diffs) n/a
2 ccsbBroad304_09988 pLX_304 0% 13.8% 12.7% V5 (many diffs) n/a
3 TRCN0000481345 AACGGGATAACACACAGCCGTAGC pLX_317 33.5% 13.8% 12.7% V5 (many diffs) n/a
Download CSV