Transcript: Human NM_213603.3

Homo sapiens zinc finger protein 789 (ZNF789), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF789 (285989)
Length:
1616
CDS:
222..1499

Additional Resources:

NCBI RefSeq record:
NM_213603.3
NBCI Gene record:
ZNF789 (285989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107991 TCAGCTCTTACGGTCCATAAA pLKO.1 945 CDS 100% 13.200 18.480 N ZNF789 n/a
2 TRCN0000107992 GCAGGCTTACTTTCCCTACTA pLKO.1 637 CDS 100% 4.950 6.930 N ZNF789 n/a
3 TRCN0000107994 CGGCATTCAACCCTTCTATGT pLKO.1 1191 CDS 100% 4.950 3.465 N ZNF789 n/a
4 TRCN0000107993 CAGATATGATGAGGATGGCAA pLKO.1 740 CDS 100% 2.640 1.848 N ZNF789 n/a
5 TRCN0000107990 GCATCAAAGAATCCATACAAA pLKO.1 1295 CDS 100% 5.625 2.813 Y ZNF789 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09988 pDONR223 100% 99.8% 99.5% None 229A>G;814C>A n/a
2 ccsbBroad304_09988 pLX_304 0% 99.8% 99.5% V5 229A>G;814C>A n/a
3 TRCN0000481345 AACGGGATAACACACAGCCGTAGC pLX_317 33.5% 99.8% 99.5% V5 229A>G;814C>A n/a
Download CSV