Transcript: Human XM_024450651.1

PREDICTED: Homo sapiens aldehyde dehydrogenase 3 family member A2 (ALDH3A2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALDH3A2 (224)
Length:
3507
CDS:
480..1427

Additional Resources:

NCBI RefSeq record:
XM_024450651.1
NBCI Gene record:
ALDH3A2 (224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027215 CCCGACTATATTCTCTGTGAA pLKO.1 630 CDS 100% 4.950 6.930 N ALDH3A2 n/a
2 TRCN0000027194 GCATAACCATAAGCTCATCAA pLKO.1 995 CDS 100% 4.950 6.930 N ALDH3A2 n/a
3 TRCN0000027191 GCAGGAAATGCTGTGATTATA pLKO.1 173 5UTR 100% 15.000 10.500 N ALDH3A2 n/a
4 TRCN0000027188 CCTCTGGCTCTTTATGTATTT pLKO.1 972 CDS 100% 13.200 9.240 N ALDH3A2 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2303 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00052 pDONR223 100% 62% 62% None 0_1ins579 n/a
2 ccsbBroad304_00052 pLX_304 0% 62% 62% V5 0_1ins579 n/a
3 TRCN0000470144 ACAACCCTTCAACAGTCACCCATA pLX_317 29.9% 62% 62% V5 0_1ins579 n/a
Download CSV