Transcript: Human NM_001003704.3

Homo sapiens mitochondrial fission process 1 (MTFP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MTFP1 (51537)
Length:
900
CDS:
113..520

Additional Resources:

NCBI RefSeq record:
NM_001003704.3
NBCI Gene record:
MTFP1 (51537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166828 CCTCCTGATCATACTCTGGTA pLKO.1 373 CDS 100% 2.640 3.696 N MTFP1 n/a
2 TRCN0000204454 CCTGATCATACTCTGGTACCT pLKO.1 376 CDS 100% 0.000 0.000 N MTFP1 n/a
3 TRCN0000244882 CGATACCTGGGCTATGCCAAT pLKO_005 170 CDS 100% 4.050 3.240 N MTFP1 n/a
4 TRCN0000244883 TGGCGGATGCCATTGACAAAG pLKO_005 270 CDS 100% 10.800 7.560 N MTFP1 n/a
5 TRCN0000204211 CATGGTGGTATGGCTGAACAA pLKO.1 772 3UTR 100% 4.950 3.465 N MTFP1 n/a
6 TRCN0000244885 CCAGCTCCTCCTGATCATACT pLKO_005 367 CDS 100% 4.950 3.465 N MTFP1 n/a
7 TRCN0000165182 GCCATTGACAAAGGCAAGAAG pLKO.1 278 CDS 100% 4.950 3.465 N MTFP1 n/a
8 TRCN0000244886 GCTTAGAGACAAAGGCTTCAA pLKO_005 515 CDS 100% 4.950 3.465 N MTFP1 n/a
9 TRCN0000188296 CTGCTTCATGTCAACCTCCTA pLKO.1 415 CDS 100% 2.640 1.848 N MTFP1 n/a
10 TRCN0000165366 GAATCCAAGATGCTGAGTGGA pLKO.1 595 3UTR 100% 2.640 1.584 N MTFP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03329 pDONR223 100% 41.5% 42.3% None 193_194ins233;266_405del n/a
2 ccsbBroad304_03329 pLX_304 0% 41.5% 42.3% V5 193_194ins233;266_405del n/a
3 TRCN0000472384 TTCCGCCGGAATGGTGCTAATATG pLX_317 96.3% 41.5% 42.3% V5 193_194ins233;266_405del n/a
4 ccsbBroadEn_08311 pDONR223 100% 41.5% 42.3% None 193_194ins233;266_405del n/a
5 ccsbBroad304_08311 pLX_304 0% 41.5% 42.3% V5 193_194ins233;266_405del n/a
6 TRCN0000466515 TTAGCCGATTTTAAACGTCAGTGT pLX_317 78.7% 41.5% 42.3% V5 193_194ins233;266_405del n/a
Download CSV