Transcript: Human XM_011534466.3

PREDICTED: Homo sapiens ring finger protein 44 (RNF44), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF44 (22838)
Length:
4613
CDS:
991..2289

Additional Resources:

NCBI RefSeq record:
XM_011534466.3
NBCI Gene record:
RNF44 (22838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004436 CCAGGTGACGTTTCTATATTT pLKO.1 3796 3UTR 100% 15.000 21.000 N RNF44 n/a
2 TRCN0000415416 AGAGCCCGTTCATGGTTGATC pLKO_005 1256 CDS 100% 4.950 6.930 N RNF44 n/a
3 TRCN0000010877 GCTCCCGTCGTACCGCTTTAA pLKO.1 2076 CDS 100% 4.400 6.160 N RNF44 n/a
4 TRCN0000417299 AGCGAGGAGTCCCTGCAATAA pLKO_005 2434 3UTR 100% 13.200 9.240 N RNF44 n/a
5 TRCN0000418920 GAAGGTCTCATGCTCTGAAAT pLKO_005 2674 3UTR 100% 13.200 9.240 N RNF44 n/a
6 TRCN0000416454 AGACGGTGTCACGAGCCATTT pLKO_005 2736 3UTR 100% 10.800 7.560 N RNF44 n/a
7 TRCN0000433819 GATGTGGAGATGGAGAACTAT pLKO_005 1981 CDS 100% 5.625 3.938 N RNF44 n/a
8 TRCN0000429877 TCCTTTGGTGTGCCATATTCT pLKO_005 1780 CDS 100% 5.625 3.938 N RNF44 n/a
9 TRCN0000004435 CTTCCTCTCGATGCTGCCAAT pLKO.1 1911 CDS 100% 4.050 2.835 N RNF44 n/a
10 TRCN0000010879 CCTGCCCTACTTCCTCTCGAT pLKO.1 1902 CDS 100% 0.880 0.616 N RNF44 n/a
11 TRCN0000432124 TCATCTCCAGTGACCACTACA pLKO_005 1514 CDS 100% 4.950 2.970 N RNF44 n/a
12 TRCN0000040552 CCAAGTGTGTTGACAAGTGGT pLKO.1 2201 CDS 100% 2.640 1.584 N Rnf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07807 pDONR223 100% 99.9% 100% None 894A>T n/a
Download CSV