Transcript: Human XM_006723406.3

PREDICTED: Homo sapiens actinin alpha 4 (ACTN4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACTN4 (81)
Length:
3507
CDS:
60..2795

Additional Resources:

NCBI RefSeq record:
XM_006723406.3
NBCI Gene record:
ACTN4 (81)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055784 GCCACACTATCGGACATCAAA pLKO.1 1389 CDS 100% 5.625 7.875 N ACTN4 n/a
2 TRCN0000055786 CCCGTATAAGAACGTCAATGT pLKO.1 593 CDS 100% 4.950 6.930 N ACTN4 n/a
3 TRCN0000055787 CAGGACATGTTCATCGTCCAT pLKO.1 1713 CDS 100% 2.640 3.696 N ACTN4 n/a
4 TRCN0000413634 GAACAAAGCGCTGGACTTTAT pLKO_005 395 CDS 100% 13.200 9.240 N ACTN4 n/a
5 TRCN0000435370 ATTGTGGACGGCAACGCAAAG pLKO_005 459 CDS 100% 6.000 4.200 N ACTN4 n/a
6 TRCN0000055783 CCTGTCACCAACCTGAACAAT pLKO.1 717 CDS 100% 5.625 3.938 N ACTN4 n/a
7 TRCN0000055785 CATCGCTTCCTTCAAGGTCTT pLKO.1 2603 CDS 100% 4.050 2.835 N ACTN4 n/a
8 TRCN0000055826 CCATCATGACTTACGTGTCTA pLKO.1 826 CDS 100% 4.950 2.475 Y ACTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00016 pDONR223 100% 99% 99.6% None (many diffs) n/a
2 ccsbBroad304_00016 pLX_304 0% 99% 99.6% V5 (many diffs) n/a
3 TRCN0000478445 AACAATATTTTCATGGGGTGCCTC pLX_317 12.7% 99% 99.6% V5 (many diffs) n/a
Download CSV