Transcript: Human XM_024454098.1

PREDICTED: Homo sapiens RNA binding motif protein 47 (RBM47), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM47 (54502)
Length:
3663
CDS:
343..2124

Additional Resources:

NCBI RefSeq record:
XM_024454098.1
NBCI Gene record:
RBM47 (54502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074564 CCGCCCAATAACTCCAGTATA pLKO.1 1887 CDS 100% 13.200 18.480 N RBM47 n/a
2 TRCN0000286622 CCGCCCAATAACTCCAGTATA pLKO_005 1887 CDS 100% 13.200 18.480 N RBM47 n/a
3 TRCN0000123518 CGTGGTATATATAGCCGATAT pLKO.1 1555 CDS 100% 10.800 15.120 N Rbm47 n/a
4 TRCN0000074567 GATGGACTTTGACGGCAAGAA pLKO.1 651 CDS 100% 4.950 6.930 N RBM47 n/a
5 TRCN0000294034 GAGGATACGCAGGCTACATAC pLKO_005 2042 CDS 100% 10.800 7.560 N RBM47 n/a
6 TRCN0000074566 GATGAAGAAGCGCGAGGAAAT pLKO.1 822 CDS 100% 10.800 7.560 N RBM47 n/a
7 TRCN0000286620 GATGAAGAAGCGCGAGGAAAT pLKO_005 822 CDS 100% 10.800 7.560 N RBM47 n/a
8 TRCN0000294033 GGGCTCAGTATTCCATGTTTC pLKO_005 1691 CDS 100% 10.800 7.560 N RBM47 n/a
9 TRCN0000074563 CGCTTGACTATTTATGAAGAA pLKO.1 2173 3UTR 100% 4.950 3.465 N RBM47 n/a
10 TRCN0000286687 CGCTTGACTATTTATGAAGAA pLKO_005 2173 3UTR 100% 4.950 3.465 N RBM47 n/a
11 TRCN0000074565 CTTCGTCATGTACTGCCACAA pLKO.1 684 CDS 100% 4.050 2.835 N RBM47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08387 pDONR223 100% 99.8% 99.8% None 57C>G;1212T>C;1693A>G n/a
2 ccsbBroad304_08387 pLX_304 0% 99.8% 99.8% V5 57C>G;1212T>C;1693A>G n/a
3 TRCN0000481351 AATTACAGAAGTTTCTTTTCTATC pLX_317 14.8% 99.8% 99.8% V5 57C>G;1212T>C;1693A>G n/a
Download CSV