Transcript: Human XM_011535266.2

PREDICTED: Homo sapiens component of oligomeric golgi complex 3 (COG3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COG3 (83548)
Length:
4348
CDS:
640..2454

Additional Resources:

NCBI RefSeq record:
XM_011535266.2
NBCI Gene record:
COG3 (83548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065232 CCCATATATTTGCTGAAGTTT pLKO.1 703 CDS 100% 5.625 7.875 N COG3 n/a
2 TRCN0000065228 GCCAAGTTAGATGATTGTATA pLKO.1 646 CDS 100% 13.200 10.560 N COG3 n/a
3 TRCN0000175082 GCCAAGTTAGATGATTGTATA pLKO.1 646 CDS 100% 13.200 10.560 N Cog3 n/a
4 TRCN0000418986 GGTGAATAGTGACGGATTTAT pLKO_005 615 5UTR 100% 15.000 10.500 N COG3 n/a
5 TRCN0000416268 GTGATAACTGCCTCGTTTAAA pLKO_005 2676 3UTR 100% 15.000 10.500 N COG3 n/a
6 TRCN0000065231 CCTGAGATAAGAGAACATTAT pLKO.1 1993 CDS 100% 13.200 9.240 N COG3 n/a
7 TRCN0000425502 GACAAAGGTTTCAGCGTTAAA pLKO_005 2115 CDS 100% 13.200 9.240 N COG3 n/a
8 TRCN0000065229 GCCTGCATTCAGTCCTTACTT pLKO.1 1726 CDS 100% 5.625 3.938 N COG3 n/a
9 TRCN0000065230 CCCATTGAACTGACTTCAGTA pLKO.1 305 5UTR 100% 4.950 3.465 N COG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12742 pDONR223 100% 26.4% 26.3% None (many diffs) n/a
2 ccsbBroad304_12742 pLX_304 0% 26.4% 26.3% V5 (many diffs) n/a
3 TRCN0000469829 GACATGATCCGTATTAACAAGGGA pLX_317 35.7% 26.4% 26.3% V5 (many diffs) n/a
Download CSV