Transcript: Human NM_006702.5

Homo sapiens patatin like phospholipase domain containing 6 (PNPLA6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PNPLA6 (10908)
Length:
4457
CDS:
272..4255

Additional Resources:

NCBI RefSeq record:
NM_006702.5
NBCI Gene record:
PNPLA6 (10908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006702.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238378 CGGCGGTCTACAGACCTTAAT pLKO_005 3935 CDS 100% 13.200 18.480 N PNPLA6 n/a
2 TRCN0000238376 CTCGCACATCGGAGTACTAAA pLKO_005 3100 CDS 100% 13.200 18.480 N PNPLA6 n/a
3 TRCN0000048881 GCCCTCTGAAGTGCTTTATAT pLKO.1 673 CDS 100% 15.000 10.500 N PNPLA6 n/a
4 TRCN0000238377 CTTCTATGGCCGGAAGATTAT pLKO_005 442 CDS 100% 13.200 9.240 N PNPLA6 n/a
5 TRCN0000238375 GGAAGTTCGACCAGATCTATG pLKO_005 3837 CDS 100% 10.800 7.560 N PNPLA6 n/a
6 TRCN0000048879 CGTGGCAACGTCATTGAGAAA pLKO.1 3902 CDS 100% 4.950 3.465 N PNPLA6 n/a
7 TRCN0000048880 CTGCACTTACATCGTGCTCAA pLKO.1 2119 CDS 100% 4.050 2.835 N PNPLA6 n/a
8 TRCN0000048882 GCAGAGATTGTGTCCCGGATT pLKO.1 4010 CDS 100% 4.050 2.835 N PNPLA6 n/a
9 TRCN0000048878 CTCCTGCTGCTATGCCTGTGA pLKO.1 4335 3UTR 100% 0.880 0.616 N PNPLA6 n/a
10 TRCN0000238374 GCACCGTGGAGTGGCTAAATA pLKO_005 2877 CDS 100% 15.000 9.000 N PNPLA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006702.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02556 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02556 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478679 ACAGCGTTTCCATTCTAGACGTAC pLX_317 8.4% 100% 100% V5 n/a
4 ccsbBroadEn_15730 pDONR223 0% 99.9% 99.8% None 1090G>C;1206G>A;2954A>G n/a
5 ccsbBroad304_15730 pLX_304 0% 99.9% 99.8% V5 1090G>C;1206G>A;2954A>G n/a
6 TRCN0000473947 CACGTTCAACGGACCGGCACAGGT pLX_317 10.6% 99.9% 99.8% V5 1090G>C;1206G>A;2954A>G n/a
Download CSV