Transcript: Human XR_001742301.2

PREDICTED: Homo sapiens family with sequence similarity 172 member A (FAM172A), transcript variant X20, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM172A (83989)
Length:
7369
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742301.2
NBCI Gene record:
FAM172A (83989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127701 GCGACGTGATTTCTATGAGAA pLKO.1 891 3UTR 100% 4.950 6.930 N FAM172A n/a
2 TRCN0000146308 CATGCAATCTATGTTTGGGAT pLKO.1 982 3UTR 100% 2.640 3.696 N FAM172A n/a
3 TRCN0000127925 GCTCAGAACCATTAGACACAT pLKO.1 1307 3UTR 100% 4.950 3.960 N FAM172A n/a
4 TRCN0000147818 GCTTTGACAAATCCACAGAAA pLKO.1 601 3UTR 100% 4.950 3.960 N FAM172A n/a
5 TRCN0000352960 GCTTTGACAAATCCACAGAAA pLKO_005 601 3UTR 100% 4.950 3.960 N FAM172A n/a
6 TRCN0000150118 CTACCGCACTGAAAGATTTAT pLKO.1 266 3UTR 100% 15.000 10.500 N FAM172A n/a
7 TRCN0000147451 GCACACAGATACCGTTTATTA pLKO.1 707 3UTR 100% 15.000 10.500 N FAM172A n/a
8 TRCN0000343350 GCACACAGATACCGTTTATTA pLKO_005 707 3UTR 100% 15.000 10.500 N FAM172A n/a
9 TRCN0000149988 CGAAACTTAAAGGCCAGATTA pLKO.1 4172 3UTR 100% 13.200 9.240 N FAM172A n/a
10 TRCN0000129368 GCAGTGGGCTAGAAGACTTAT pLKO.1 663 3UTR 100% 13.200 9.240 N FAM172A n/a
11 TRCN0000147292 GCTGAAGGATATGGAGTAATA pLKO.1 739 3UTR 100% 13.200 9.240 N FAM172A n/a
12 TRCN0000128275 GCCTTATTTGAGGACATGATA pLKO.1 2936 3UTR 100% 5.625 3.938 N FAM172A n/a
13 TRCN0000148987 GCCAGCTAATTGTGAGAGTTT pLKO.1 2210 3UTR 100% 4.950 3.465 N FAM172A n/a
14 TRCN0000148299 CCTGAAGAACATGCAATCTAT pLKO.1 973 3UTR 100% 5.625 3.375 N FAM172A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04314 pDONR223 100% 16.9% None 1_174del;1198_1284del;1510_7369del n/a
2 ccsbBroad304_04314 pLX_304 0% 16.9% V5 1_174del;1198_1284del;1510_7369del n/a
3 TRCN0000479117 CGCCGGTCCCAGCCCATAGAACCT pLX_317 34.4% 16.9% V5 1_174del;1198_1284del;1510_7369del n/a
Download CSV