Transcript: Human NM_017412.4

Homo sapiens frizzled class receptor 3 (FZD3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
FZD3 (7976)
Length:
13770
CDS:
523..2523

Additional Resources:

NCBI RefSeq record:
NM_017412.4
NBCI Gene record:
FZD3 (7976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017412.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363128 GTGCACTCTACGCTCCTATTT pLKO_005 767 CDS 100% 13.200 18.480 N FZD3 n/a
2 TRCN0000008326 CGCTCCTATTTGTATGGAATA pLKO.1 777 CDS 100% 10.800 15.120 N FZD3 n/a
3 TRCN0000008327 CCTCGACTTGTGGATCTGAAT pLKO.1 934 CDS 100% 4.950 6.930 N FZD3 n/a
4 TRCN0000363091 ATCCTGAAAGGCCTATTATAT pLKO_005 1220 CDS 100% 15.000 12.000 N FZD3 n/a
5 TRCN0000008328 GCCTAATCTTCTGAATCATTA pLKO.1 660 CDS 100% 13.200 10.560 N FZD3 n/a
6 TRCN0000008324 CCTCAGTCCAAAGTGGTGATT pLKO.1 3620 3UTR 100% 4.950 3.960 N FZD3 n/a
7 TRCN0000363100 ACTGTCATTTGCTCGCTATTT pLKO_005 1116 CDS 100% 13.200 9.240 N FZD3 n/a
8 TRCN0000008325 GCAGAGAATATCACATTCCAT pLKO.1 1895 CDS 100% 3.000 2.100 N FZD3 n/a
9 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6911 3UTR 100% 10.800 5.400 Y MRPS16 n/a
10 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 9876 3UTR 100% 4.950 2.475 Y GJD4 n/a
11 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 9876 3UTR 100% 4.950 2.475 Y C9orf85 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9741 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 9742 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6911 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017412.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489105 CAACGCTGACATACCCGTGCGCGG pLX_317 17.9% 99.9% 100% V5 (not translated due to prior stop codon) 435A>G n/a
Download CSV