Transcript: Human NM_173354.5

Homo sapiens salt inducible kinase 1 (SIK1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SIK1 (150094)
Length:
4747
CDS:
137..2488

Additional Resources:

NCBI RefSeq record:
NM_173354.5
NBCI Gene record:
SIK1 (150094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173354.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199588 GCGCGTGCATTGATTACTATC pLKO.1 2891 3UTR 100% 10.800 6.480 N SIK1 n/a
2 TRCN0000314588 GCGCGTGCATTGATTACTATC pLKO_005 2891 3UTR 100% 10.800 6.480 N SIK1 n/a
3 TRCN0000314530 ACGATTAGATTCAAGCAATTT pLKO_005 319 CDS 100% 13.200 6.600 Y SIK1 n/a
4 TRCN0000199737 GCCAAAGATTGACCCAGTTAC pLKO.1 3955 3UTR 100% 10.800 5.400 Y SIK1 n/a
5 TRCN0000314529 GCCAAAGATTGACCCAGTTAC pLKO_005 3955 3UTR 100% 10.800 5.400 Y SIK1 n/a
6 TRCN0000199689 GCGGAAGAAGTTCTGGCAAAT pLKO.1 514 CDS 100% 10.800 5.400 Y SIK1 n/a
7 TRCN0000001362 GAGAAATGTATGCCAAATGAT pLKO.1 4639 3UTR 100% 5.625 2.813 Y SIK1 n/a
8 TRCN0000199428 GATGGCAACATGGACATCAAG pLKO.1 608 CDS 100% 4.950 2.475 Y SIK1 n/a
9 TRCN0000001364 CATTTATTACCTCCTCCTTGA pLKO.1 1144 CDS 100% 4.050 2.025 Y SIK1 n/a
10 TRCN0000001366 CCATTTATTACCTCCTCCTTG pLKO.1 1143 CDS 100% 4.050 2.025 Y SIK1 n/a
11 TRCN0000199404 CTGACAGTTGTCTGACCTTCT pLKO.1 1650 CDS 100% 4.050 2.025 Y SIK1 n/a
12 TRCN0000314528 CTGACAGTTGTCTGACCTTCT pLKO_005 1650 CDS 100% 4.050 2.025 Y SIK1 n/a
13 TRCN0000199637 GTTCAGCTGATGAAGCTTCTG pLKO.1 359 CDS 100% 4.050 2.025 Y SIK1 n/a
14 TRCN0000350456 GTTCAGCTGATGAAGCTTCTG pLKO_005 359 CDS 100% 4.050 2.025 Y SIK1 n/a
15 TRCN0000001365 CATCCACACATCATAAAGCTT pLKO.1 383 CDS 100% 3.000 1.500 Y SIK1 n/a
16 TRCN0000001363 CCATCCACACATCATAAAGCT pLKO.1 382 CDS 100% 3.000 1.500 Y SIK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173354.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09665 pDONR223 100% 99.9% 99.8% None 1844C>T;1848C>T n/a
2 ccsbBroad304_09665 pLX_304 0% 99.9% 99.8% V5 1844C>T;1848C>T n/a
3 TRCN0000468228 GCAGAGATGTTATTCGGAGACCGA pLX_317 19.8% 99.9% 99.8% V5 1844C>T;1848C>T n/a
4 ccsbBroadEn_15264 pDONR223 0% 99.9% 99.8% None 1844C>T;1848C>T n/a
5 ccsbBroad304_15264 pLX_304 0% 99.9% 99.8% V5 1844C>T;1848C>T n/a
6 TRCN0000470980 AGCTCCACAGTAGAAGGAGTGCCT pLX_317 19% 99.9% 99.8% V5 1844C>T;1848C>T n/a
7 TRCN0000488093 GGAAGTAAAGTCCGGTTTGGTTTA pLX_317 14% 99.9% 99.8% V5 (not translated due to prior stop codon) 1844C>T;1848C>T n/a
8 TRCN0000489745 CCAAATAGGTATCCTGCGTGACTT pLX_317 17.3% 99.8% 99.7% V5 1844C>T;1848C>T;2349_2350insG n/a
Download CSV