Transcript: Human XM_017001914.2

PREDICTED: Homo sapiens pogo transposable element derived with KRAB domain (POGK), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POGK (57645)
Length:
5928
CDS:
198..2027

Additional Resources:

NCBI RefSeq record:
XM_017001914.2
NBCI Gene record:
POGK (57645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232776 CCAACGAGGGACTCATCATAT pLKO_005 4559 3UTR 100% 13.200 18.480 N POGK n/a
2 TRCN0000108110 CCCACATAAGTTTGAGTGTTA pLKO.1 5218 3UTR 100% 4.950 6.930 N POGK n/a
3 TRCN0000232773 TTGGGTTGGTGTCGAAGAATG pLKO_005 1116 CDS 100% 10.800 8.640 N POGK n/a
4 TRCN0000232775 AGTTACCACCGTACATCATTT pLKO_005 1426 CDS 100% 13.200 9.240 N POGK n/a
5 TRCN0000232774 ATGCAGATGAGACGCCCATTT pLKO_005 1282 CDS 100% 10.800 7.560 N POGK n/a
6 TRCN0000232772 GCCAAGCAGTTTGGAGTATTG pLKO_005 858 CDS 100% 10.800 7.560 N POGK n/a
7 TRCN0000108112 CCGATGAGGAATGGGAAGTTT pLKO.1 367 CDS 100% 5.625 3.938 N POGK n/a
8 TRCN0000108114 GTGCCATATCTCCAGCAACTT pLKO.1 1904 CDS 100% 4.950 3.465 N POGK n/a
9 TRCN0000108111 CCATTTGTTTAGAGGTGCCAT pLKO.1 1297 CDS 100% 2.640 1.848 N POGK n/a
10 TRCN0000108113 CCCATTTGTTTAGAGGTGCCA pLKO.1 1296 CDS 100% 0.660 0.396 N POGK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08753 pDONR223 100% 99.9% 99.8% None 1827C>A n/a
2 ccsbBroad304_08753 pLX_304 0% 99.9% 99.8% V5 1827C>A n/a
3 TRCN0000474134 AATCGAGTCAGAACACCTCGGCGC pLX_317 27.2% 99.9% 99.8% V5 1827C>A n/a
Download CSV