Transcript: Human XM_011537184.3

PREDICTED: Homo sapiens nucleotide binding protein like (NUBPL), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUBPL (80224)
Length:
6159
CDS:
3636..4046

Additional Resources:

NCBI RefSeq record:
XM_011537184.3
NBCI Gene record:
NUBPL (80224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419822 CCTTTAGAAATCACGAGTTTA pLKO_005 4306 3UTR 100% 13.200 18.480 N NUBPL n/a
2 TRCN0000149758 GCAGTTATCAGTCTCACAGAA pLKO.1 3659 CDS 100% 4.950 6.930 N NUBPL n/a
3 TRCN0000412429 GACATTCCCTTACACCTTAAT pLKO_005 3903 CDS 100% 13.200 10.560 N NUBPL n/a
4 TRCN0000146540 GCCAAAGCTTACTTGAGGATT pLKO.1 3984 CDS 100% 4.950 3.465 N NUBPL n/a
5 TRCN0000128303 GCTTGGATTTGAACTTGAGTA pLKO.1 4803 3UTR 100% 4.950 2.970 N NUBPL n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2997 5UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4908 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2987 5UTR 100% 13.200 6.600 Y IQCC n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4909 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2994 5UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12686 pDONR223 100% 46.9% 46.7% None 0_1ins459;44A>C n/a
2 ccsbBroad304_12686 pLX_304 0% 46.9% 46.7% V5 0_1ins459;44A>C n/a
3 TRCN0000492280 AAAACTATACCCAGTACGAGCCAT pLX_317 50.2% 46.9% 46.7% V5 0_1ins459;44A>C n/a
Download CSV