Transcript: Human NM_001271594.2

Homo sapiens sestrin 3 (SESN3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
SESN3 (143686)
Length:
9279
CDS:
476..1537

Additional Resources:

NCBI RefSeq record:
NM_001271594.2
NBCI Gene record:
SESN3 (143686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412760 ATCTGATGTCTCTCGATATAT pLKO_005 1021 CDS 100% 15.000 12.000 N SESN3 n/a
2 TRCN0000432269 GGTCTACAATCTCACATATAA pLKO_005 1201 CDS 100% 15.000 10.500 N SESN3 n/a
3 TRCN0000428761 GGCTAATATCAGTCAACAATT pLKO_005 732 CDS 100% 13.200 9.240 N SESN3 n/a
4 TRCN0000088252 GCCTTAATGGAAAGGATGAAA pLKO.1 848 CDS 100% 5.625 3.938 N Sesn3 n/a
5 TRCN0000141228 CCCATGAGGATGTTGACACAA pLKO.1 1233 CDS 100% 4.950 3.465 N SESN3 n/a
6 TRCN0000143446 GCTATCCTGAGAGAACTACAA pLKO.1 1383 CDS 100% 4.950 3.465 N SESN3 n/a
7 TRCN0000122213 GCTGAACTTCTTTATGCTCTT pLKO.1 1490 CDS 100% 4.050 2.835 N SESN3 n/a
8 TRCN0000144279 CGTACTAACTTTCTTGTGGAA pLKO.1 413 5UTR 100% 2.640 1.848 N SESN3 n/a
9 TRCN0000144367 CAGTTCTCTAGTGTCAAAGTT pLKO.1 1630 3UTR 100% 5.625 3.375 N SESN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13218 pDONR223 100% 36% 34.8% None (many diffs) n/a
2 ccsbBroad304_13218 pLX_304 0% 36% 34.8% V5 (many diffs) n/a
3 TRCN0000473047 ATGGACTATCATGTATGCTTCAAC pLX_317 45% 36% 34.8% V5 (many diffs) n/a
Download CSV