Transcript: Human NM_001206572.2

Homo sapiens sortilin related VPS10 domain containing receptor 1 (SORCS1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SORCS1 (114815)
Length:
7605
CDS:
181..3720

Additional Resources:

NCBI RefSeq record:
NM_001206572.2
NBCI Gene record:
SORCS1 (114815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061644 GCGGAAGTGTATGCAAGGAAA pLKO.1 2292 CDS 100% 4.950 6.930 N SORCS1 n/a
2 TRCN0000432614 TATGAGGTAGCAGGGATAAAG pLKO_005 1588 CDS 100% 13.200 9.240 N SORCS1 n/a
3 TRCN0000419673 TGTTCGTCATCTACAAGTTTA pLKO_005 3527 CDS 100% 13.200 9.240 N SORCS1 n/a
4 TRCN0000061645 CCTACCAACAAGCGTAAGATA pLKO.1 889 CDS 100% 5.625 3.938 N SORCS1 n/a
5 TRCN0000061643 CGGCTGAACTTCTACATTCAA pLKO.1 985 CDS 100% 5.625 3.938 N SORCS1 n/a
6 TRCN0000061646 CCATCGCAGTATATGAGGAAT pLKO.1 3086 CDS 100% 4.950 3.465 N SORCS1 n/a
7 TRCN0000061647 GCCACATTACTACGTGTCCTA pLKO.1 1341 CDS 100% 2.640 1.848 N SORCS1 n/a
8 TRCN0000417820 TTTGGAGGTCAACCGATTATG pLKO_005 800 CDS 100% 13.200 7.920 N SORCS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492355 CGACCAAGTGATGCCGATTCTTCT pLX_317 13.5% 96.2% 94.6% V5 (many diffs) n/a
2 TRCN0000491704 AAAAATAGACCATACGTCCGGAAT pLX_317 4.7% 96.2% 94.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV