Transcript: Human XM_017004744.2

PREDICTED: Homo sapiens mitotic spindle organizing protein 2A (MZT2A), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MZT2A (653784)
Length:
2015
CDS:
273..824

Additional Resources:

NCBI RefSeq record:
XM_017004744.2
NBCI Gene record:
MZT2A (653784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269637 CCGTCTTCCAGATGCTCAAGT pLKO_005 637 CDS 100% 4.950 2.475 Y MZT2A n/a
2 TRCN0000370962 CCAGATGCTCAAGTCCATGTG pLKO_005 644 CDS 100% 4.050 2.025 Y MZT2B n/a
3 TRCN0000269638 ATGCTCAAGTCCATGTGTGCC pLKO_005 648 CDS 100% 2.160 1.080 Y MZT2A n/a
4 TRCN0000371012 CGACGTGTTCAAGATCCTGGT pLKO_005 584 CDS 100% 2.160 1.080 Y MZT2B n/a
5 TRCN0000269639 GACGTGTTCAAGATCCTGGTG pLKO_005 585 CDS 100% 2.160 1.080 Y MZT2A n/a
6 TRCN0000284056 ACCGAGGAGATGGAGCTGTAC pLKO_005 528 CDS 100% 1.350 0.675 Y MZT2A n/a
7 TRCN0000283713 CACCGAGGAGATGGAGCTGTA pLKO_005 527 CDS 100% 1.350 0.675 Y MZT2B n/a
8 TRCN0000370961 GTGGACCTGCTGAAGCTGAAC pLKO_005 603 CDS 100% 1.350 0.675 Y MZT2B n/a
9 TRCN0000370914 CCCTCGCCGTCTTCCAGATGC pLKO_005 631 CDS 100% 0.000 0.000 Y MZT2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04172 pDONR223 100% 58.5% 51.5% None (many diffs) n/a
2 ccsbBroad304_04172 pLX_304 0% 58.5% 51.5% V5 (many diffs) n/a
3 TRCN0000480888 AGGCTGACATTGAAGACGACCGTA pLX_317 85.8% 58.5% 51.5% V5 (many diffs) n/a
4 ccsbBroadEn_16169 pDONR223 0% 41.6% 34.7% None (many diffs) n/a
5 ccsbBroad304_16169 pLX_304 0% 41.6% 34.7% V5 (many diffs) n/a
6 TRCN0000470189 ATCGGAGGTTAAGTGCCTATTGCC pLX_317 77.5% 41.6% 34.7% V5 (many diffs) n/a
Download CSV