Transcript: Human NM_001127207.2

Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a like 1 (SMARCAL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SMARCAL1 (50485)
Length:
3070
CDS:
130..2994

Additional Resources:

NCBI RefSeq record:
NM_001127207.2
NBCI Gene record:
SMARCAL1 (50485)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236114 CCACAGTCCACGTAGTCAAAT pLKO_005 459 CDS 100% 13.200 18.480 N SMARCAL1 n/a
2 TRCN0000083568 CGGAACTCATTGCAGTGTTTA pLKO.1 896 CDS 100% 13.200 18.480 N SMARCAL1 n/a
3 TRCN0000218721 CTTTGCTAACCCAACTCATAA pLKO_005 603 CDS 100% 13.200 18.480 N SMARCAL1 n/a
4 TRCN0000236116 AGGTGTTGATTGGGTACAATG pLKO_005 875 CDS 100% 10.800 15.120 N SMARCAL1 n/a
5 TRCN0000236115 CTGATTCAAGAGAAGATTAAA pLKO_005 2662 CDS 100% 15.000 10.500 N SMARCAL1 n/a
6 TRCN0000083571 CGGGCTTTCTGAGACCAATTT pLKO.1 2697 CDS 100% 13.200 9.240 N SMARCAL1 n/a
7 TRCN0000083570 CCCTTTGCTAACCCAACTCAT pLKO.1 601 CDS 100% 4.950 3.465 N SMARCAL1 n/a
8 TRCN0000083569 GCGGAACTCATTGCAGTGTTT pLKO.1 895 CDS 100% 4.950 3.465 N SMARCAL1 n/a
9 TRCN0000083572 GCTCATCTAATGCTGACCAAA pLKO.1 362 CDS 100% 4.950 3.465 N SMARCAL1 n/a
10 TRCN0000236117 AGTTATTCACAGGACCTTATT pLKO_005 1171 CDS 100% 13.200 7.920 N SMARCAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03143 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03143 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466624 TTGAGTTTAACAAAGCCTCTCTTT pLX_317 11.7% 100% 100% V5 n/a
Download CSV