Transcript: Human NM_152597.5

Homo sapiens fibrous sheath interacting protein 1 (FSIP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FSIP1 (161835)
Length:
2816
CDS:
222..1967

Additional Resources:

NCBI RefSeq record:
NM_152597.5
NBCI Gene record:
FSIP1 (161835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152597.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172976 GCAAGCAACTTGAACTCTGGT pLKO.1 357 CDS 100% 2.640 2.112 N FSIP1 n/a
2 TRCN0000242495 CAGATGCAGAAACTCAATAAA pLKO_005 855 CDS 100% 15.000 10.500 N FSIP1 n/a
3 TRCN0000242497 GTCGCTCTTTGTGGATTATAT pLKO_005 2093 3UTR 100% 15.000 10.500 N FSIP1 n/a
4 TRCN0000242498 CTCAGTGTTTCATACTCAAAT pLKO_005 812 CDS 100% 13.200 9.240 N FSIP1 n/a
5 TRCN0000242496 AGAATGTAAAGAACCCTAATC pLKO_005 1949 CDS 100% 10.800 7.560 N FSIP1 n/a
6 TRCN0000242499 CAGATGAGCAGGAGACTAAAG pLKO_005 1918 CDS 100% 10.800 7.560 N FSIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152597.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09738 pDONR223 100% 99.8% 99.6% None 1061G>A;1204T>C;1476C>T n/a
2 ccsbBroad304_09738 pLX_304 0% 99.8% 99.6% V5 (not translated due to frame shift) 1061G>A;1204T>C;1476C>T n/a
3 TRCN0000479026 GTATTGGCCTGAGGACTCTGATTA pLX_317 22.9% 99.8% 99.6% V5 (not translated due to frame shift) 1061G>A;1204T>C;1476C>T n/a
Download CSV