Transcript: Human NM_001184723.2

Homo sapiens transmembrane 4 L six family member 18 (TM4SF18), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TM4SF18 (116441)
Length:
3642
CDS:
57..662

Additional Resources:

NCBI RefSeq record:
NM_001184723.2
NBCI Gene record:
TM4SF18 (116441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422830 GACATGGCCATCTATCTAAAT pLKO_005 691 3UTR 100% 13.200 18.480 N TM4SF18 n/a
2 TRCN0000144805 GCTTGCACTTTGGAGTATAAT pLKO.1 104 CDS 100% 15.000 10.500 N TM4SF18 n/a
3 TRCN0000419518 TGTAGACTTGAGGGCAATATT pLKO_005 725 3UTR 100% 15.000 10.500 N TM4SF18 n/a
4 TRCN0000145478 GAAATACTTCTGCCCTTTGAT pLKO.1 869 3UTR 100% 5.625 3.938 N TM4SF18 n/a
5 TRCN0000144163 CAGCAATAAACTCACCAACTA pLKO.1 173 CDS 100% 4.950 3.465 N TM4SF18 n/a
6 TRCN0000141630 CCGAATGGGCAAACTTCCTAT pLKO.1 147 CDS 100% 4.950 3.465 N TM4SF18 n/a
7 TRCN0000122444 GCTGGACGTTTCCTTACAGAT pLKO.1 459 CDS 100% 4.950 3.465 N TM4SF18 n/a
8 TRCN0000122050 CCTTTGATCAAACAAATCCAT pLKO.1 882 3UTR 100% 3.000 2.100 N TM4SF18 n/a
9 TRCN0000144718 GAATCTGTACTAGGGAAGTAA pLKO.1 909 3UTR 100% 5.625 3.375 N TM4SF18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04710 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04710 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479183 AAACGTTAGTTCCCGCCGTTCCAG pLX_317 67.5% 100% 100% V5 n/a
Download CSV