Transcript: Human XM_024452827.1

PREDICTED: Homo sapiens bromodomain adjacent to zinc finger domain 2B (BAZ2B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAZ2B (29994)
Length:
7803
CDS:
854..7633

Additional Resources:

NCBI RefSeq record:
XM_024452827.1
NBCI Gene record:
BAZ2B (29994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019928 CCTAGCTCTTTGCAGTATGAT pLKO.1 7237 CDS 100% 5.625 7.875 N BAZ2B n/a
2 TRCN0000200866 GTGCAGTTCTTACGAAACTTT pLKO.1 4226 CDS 100% 5.625 7.875 N Baz2b n/a
3 TRCN0000346848 GTGCAGTTCTTACGAAACTTT pLKO_005 4226 CDS 100% 5.625 7.875 N Baz2b n/a
4 TRCN0000019926 CGAGACAATGTTTCCGAGATT pLKO.1 4454 CDS 100% 4.950 6.930 N BAZ2B n/a
5 TRCN0000201016 CCAGGTGCTATTACATGGTAT pLKO.1 1801 CDS 100% 4.950 3.960 N Baz2b n/a
6 TRCN0000346847 CCAGGTGCTATTACATGGTAT pLKO_005 1801 CDS 100% 4.950 3.960 N Baz2b n/a
7 TRCN0000370731 TCGACAAGAACATTGATTATA pLKO_005 4629 CDS 100% 15.000 10.500 N BAZ2B n/a
8 TRCN0000370684 AGAGCCTGAAGAAGGTTATTG pLKO_005 2250 CDS 100% 13.200 9.240 N BAZ2B n/a
9 TRCN0000019925 CCTCTGAAGAATCTAGTTTAT pLKO.1 2151 CDS 100% 13.200 9.240 N BAZ2B n/a
10 TRCN0000365481 GAGAGTGAAGCACAACATAAA pLKO_005 1772 CDS 100% 13.200 9.240 N BAZ2B n/a
11 TRCN0000370683 GGTGCTATTACATGGTATTTC pLKO_005 1804 CDS 100% 13.200 9.240 N BAZ2B n/a
12 TRCN0000019927 CCAATCAGAATCAGATAGTAA pLKO.1 2797 CDS 100% 5.625 3.938 N BAZ2B n/a
13 TRCN0000365482 TCAAGGAGAAGTAGCATATTA pLKO_005 3202 CDS 100% 15.000 9.000 N BAZ2B n/a
14 TRCN0000144930 GAAGAAGAAGATGAGGAAGAA pLKO.1 2750 CDS 100% 4.950 2.475 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11918 pDONR223 100% 28.4% 27.9% None (many diffs) n/a
2 ccsbBroad304_11918 pLX_304 0% 28.4% 27.9% V5 (many diffs) n/a
3 TRCN0000475683 CTGCGACAGGTTACAGGCAGTTAC pLX_317 14% 28.4% 27.9% V5 (many diffs) n/a
Download CSV