Transcript: Human XM_011523828.3

PREDICTED: Homo sapiens integrin subunit alpha E (ITGAE), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGAE (3682)
Length:
4116
CDS:
484..3897

Additional Resources:

NCBI RefSeq record:
XM_011523828.3
NBCI Gene record:
ITGAE (3682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343297 GCGTCGTGAATGTCCGTTTAT pLKO_005 2630 CDS 100% 13.200 18.480 N ITGAE n/a
2 TRCN0000369783 TATCCACTGGGAGAGGCTATC pLKO_005 3905 3UTR 100% 6.000 8.400 N ITGAE n/a
3 TRCN0000057787 CCTCAACCTTACGACAGTCAT pLKO.1 1491 CDS 100% 4.950 6.930 N ITGAE n/a
4 TRCN0000369713 TGCAGATCCTTGGTGAAATAT pLKO_005 3617 CDS 100% 15.000 10.500 N ITGAE n/a
5 TRCN0000369784 TCACTCTGAGGAGTTACTAAA pLKO_005 3582 CDS 100% 13.200 9.240 N ITGAE n/a
6 TRCN0000352828 ACCCAGCATCCTTTGCATTAC pLKO_005 3947 3UTR 100% 10.800 7.560 N ITGAE n/a
7 TRCN0000343296 TTCTGGTGTTGATCGTGATTC pLKO_005 3764 CDS 100% 10.800 7.560 N ITGAE n/a
8 TRCN0000057786 CCCTGAACATTAACCTAACTA pLKO.1 3092 CDS 100% 5.625 3.938 N ITGAE n/a
9 TRCN0000057784 GCCAACTTCTTCGACCTTGAA pLKO.1 949 CDS 100% 4.950 3.465 N ITGAE n/a
10 TRCN0000057783 GCCTGCAAGAATAAGCTGTTT pLKO.1 2998 CDS 100% 4.950 2.970 N ITGAE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06462 pDONR223 100% 93.5% 93.3% None (many diffs) n/a
2 ccsbBroad304_06462 pLX_304 0% 93.5% 93.3% V5 (many diffs) n/a
3 TRCN0000468759 CCTAGGCAGGACCTTTAACCAAAA pLX_317 12.5% 93.5% 93.3% V5 (many diffs) n/a
Download CSV