Transcript: Human NM_015714.4

Homo sapiens G0/G1 switch 2 (G0S2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
G0S2 (50486)
Length:
876
CDS:
171..482

Additional Resources:

NCBI RefSeq record:
NM_015714.4
NBCI Gene record:
G0S2 (50486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015714.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183858 CACTGCATTGTCATGACATTT pLKO.1 717 3UTR 100% 13.200 9.240 N G0S2 n/a
2 TRCN0000431873 AGCATCCACCAAAGGAGTTTG pLKO_005 672 3UTR 100% 10.800 7.560 N G0S2 n/a
3 TRCN0000147462 CATTTCCAACACTGTGTGAAT pLKO.1 733 3UTR 100% 4.950 3.465 N G0S2 n/a
4 TRCN0000179555 GCACTGCATTGTCATGACATT pLKO.1 716 3UTR 100% 4.950 3.465 N G0S2 n/a
5 TRCN0000147426 GCATTGTCATGACATTTCCAA pLKO.1 721 3UTR 100% 3.000 2.100 N G0S2 n/a
6 TRCN0000429085 AGACCGAGAGAGGAATGGAGA pLKO_005 532 3UTR 100% 2.640 1.848 N G0S2 n/a
7 TRCN0000180443 GCTGACATCTAGAACTGACCT pLKO.1 645 3UTR 100% 2.640 1.848 N G0S2 n/a
8 TRCN0000417794 GATGGTGAAGCTGTACGTGCT pLKO_005 236 CDS 100% 2.160 1.512 N G0S2 n/a
9 TRCN0000415453 TTTGGACTTAACTTCAGAGAA pLKO_005 621 3UTR 100% 4.950 2.970 N G0S2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015714.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08175 pDONR223 100% 99.6% 100% None 297G>A n/a
2 ccsbBroad304_08175 pLX_304 0% 99.6% 100% V5 297G>A n/a
3 TRCN0000475031 TACCTGGACCTTACGTCGGACTGC pLX_317 100% 99.6% 100% V5 297G>A n/a
Download CSV