Transcript: Human NR_159454.1

Homo sapiens DnaJ heat shock protein family (Hsp40) member C8 (DNAJC8), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
DNAJC8 (22826)
Length:
1885
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159454.1
NBCI Gene record:
DNAJC8 (22826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022284 GCTTCGAAGGACTCATTCTTT pLKO.1 965 3UTR 100% 5.625 7.875 N DNAJC8 n/a
2 TRCN0000342809 GCTTCGAAGGACTCATTCTTT pLKO_005 965 3UTR 100% 5.625 7.875 N DNAJC8 n/a
3 TRCN0000022287 CGAGGAAGCATTTATGACCTT pLKO.1 79 3UTR 100% 2.640 3.696 N DNAJC8 n/a
4 TRCN0000342805 CGAGGAAGCATTTATGACCTT pLKO_005 79 3UTR 100% 2.640 3.696 N DNAJC8 n/a
5 TRCN0000022286 GCTTACAAGTTGCTACTGGAT pLKO.1 469 3UTR 100% 2.640 2.112 N DNAJC8 n/a
6 TRCN0000342806 GCTTACAAGTTGCTACTGGAT pLKO_005 469 3UTR 100% 2.640 2.112 N DNAJC8 n/a
7 TRCN0000022288 GCTGTTCAAACAAGCTGTATA pLKO.1 621 3UTR 100% 13.200 9.240 N DNAJC8 n/a
8 TRCN0000342808 GCTGTTCAAACAAGCTGTATA pLKO_005 621 3UTR 100% 13.200 9.240 N DNAJC8 n/a
9 TRCN0000022285 CCTACAATTGTAGAGGAGGAT pLKO.1 592 3UTR 100% 2.640 1.848 N DNAJC8 n/a
10 TRCN0000342807 CCTACAATTGTAGAGGAGGAT pLKO_005 592 3UTR 100% 2.640 1.848 N DNAJC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07804 pDONR223 100% 40.2% None (many diffs) n/a
2 ccsbBroad304_07804 pLX_304 0% 40.2% V5 (many diffs) n/a
3 TRCN0000491969 CTATTCAATCGCCAATAGCAGCTT pLX_317 24.3% 40.2% V5 (many diffs) n/a
Download CSV