Transcript: Human XM_005256872.5

PREDICTED: Homo sapiens nuclear receptor corepressor 1 (NCOR1), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCOR1 (9611)
Length:
8703
CDS:
258..7802

Additional Resources:

NCBI RefSeq record:
XM_005256872.5
NBCI Gene record:
NCOR1 (9611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256872.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060655 CGCAGTATTGTCCAAATTATT pLKO.1 954 CDS 100% 15.000 21.000 N NCOR1 n/a
2 TRCN0000310755 GTGATCATCACCCGGCAAATT pLKO_005 6282 CDS 100% 13.200 18.480 N NCOR1 n/a
3 TRCN0000314177 GTGATCATCACCCGGCAAATT pLKO_005 6282 CDS 100% 13.200 18.480 N Ncor1 n/a
4 TRCN0000060654 GCCTTAAATATCCCAAACAAA pLKO.1 4411 CDS 100% 5.625 7.875 N NCOR1 n/a
5 TRCN0000303750 CTATCAGCCAGAGGTTGTTAA pLKO_005 6452 CDS 100% 13.200 9.240 N NCOR1 n/a
6 TRCN0000060653 GCCCACAGATGATGAAGAAAT pLKO.1 7928 3UTR 100% 13.200 9.240 N NCOR1 n/a
7 TRCN0000299678 GCCCACAGATGATGAAGAAAT pLKO_005 7928 3UTR 100% 13.200 9.240 N NCOR1 n/a
8 TRCN0000060656 GCCATCAAACACAATGTCAAA pLKO.1 4671 CDS 100% 4.950 3.465 N NCOR1 n/a
9 TRCN0000310464 GCCATCAAACACAATGTCAAA pLKO_005 4671 CDS 100% 4.950 3.465 N NCOR1 n/a
10 TRCN0000060657 GCTCTCAAAGTTCAGACTCTT pLKO.1 6331 CDS 100% 4.950 2.970 N NCOR1 n/a
11 TRCN0000299677 GCTCTCAAAGTTCAGACTCTT pLKO_005 6331 CDS 100% 4.950 2.970 N NCOR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256872.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10302 pDONR223 100% 3.8% 3.5% None (many diffs) n/a
2 ccsbBroad304_10302 pLX_304 0% 3.8% 3.5% V5 (many diffs) n/a
3 TRCN0000466119 TTAAAGCTTTTAAGCAAGACCAGA pLX_317 100% 3.8% 3.5% V5 (many diffs) n/a
Download CSV