Transcript: Human XM_011541687.3

PREDICTED: Homo sapiens pre-mRNA processing factor 38B (PRPF38B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRPF38B (55119)
Length:
991
CDS:
283..894

Additional Resources:

NCBI RefSeq record:
XM_011541687.3
NBCI Gene record:
PRPF38B (55119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541687.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294732 TGTCGTCGCCTTACTTCAAAG pLKO_005 482 CDS 100% 10.800 15.120 N Prpf38b n/a
2 TRCN0000074335 GCGCTTGGATTTATGTATATA pLKO.1 757 CDS 100% 15.000 12.000 N PRPF38B n/a
3 TRCN0000074334 CGAAAGCAAGTGATGGGTCTT pLKO.1 706 CDS 100% 4.050 2.430 N PRPF38B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541687.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12162 pDONR223 100% 92.9% 91.6% None (many diffs) n/a
2 ccsbBroad304_12162 pLX_304 0% 92.9% 91.6% V5 (many diffs) n/a
3 TRCN0000467230 TTGATTCCCGCAGGTTAACACAGA pLX_317 57.2% 92.9% 91.6% V5 (many diffs) n/a
Download CSV