Transcript: Human NM_052880.5

Homo sapiens phosphoinositide-3-kinase interacting protein 1 (PIK3IP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
PIK3IP1 (113791)
Length:
2420
CDS:
145..936

Additional Resources:

NCBI RefSeq record:
NM_052880.5
NBCI Gene record:
PIK3IP1 (113791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052880.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135363 GAAAGTATGTGAGAGGGAGAT pLKO.1 762 CDS 100% 4.050 3.240 N PIK3IP1 n/a
2 TRCN0000437651 TACGTGCTGGGCATTACCATG pLKO_005 655 CDS 100% 4.050 3.240 N PIK3IP1 n/a
3 TRCN0000134137 CCACTTTGTGTTCTGGTTAAA pLKO.1 1011 3UTR 100% 13.200 9.240 N PIK3IP1 n/a
4 TRCN0000431594 ACACTGTTATTCATGGTTAAG pLKO_005 1328 3UTR 100% 10.800 7.560 N PIK3IP1 n/a
5 TRCN0000138560 CCTAGCCATAGAGCTTCCTTT pLKO.1 2157 3UTR 100% 4.950 3.465 N PIK3IP1 n/a
6 TRCN0000433774 GAAATCCAGGAAGCGTCTGAA pLKO_005 487 CDS 100% 4.950 3.465 N PIK3IP1 n/a
7 TRCN0000133982 CCTGTTTCATAAGGAAAGGAA pLKO.1 1569 3UTR 100% 3.000 2.100 N PIK3IP1 n/a
8 TRCN0000137987 GTGATCATCATTGCCATCGGA pLKO.1 679 CDS 100% 0.750 0.525 N PIK3IP1 n/a
9 TRCN0000133917 CATTACCATGATGGTGATCAT pLKO.1 666 CDS 100% 0.495 0.347 N PIK3IP1 n/a
10 TRCN0000135429 GATGGTGATCATCATTGCCAT pLKO.1 675 CDS 100% 2.640 1.584 N PIK3IP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052880.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09389 pDONR223 100% 99.8% 99.6% None 752C>G n/a
2 ccsbBroad304_09389 pLX_304 0% 99.8% 99.6% V5 752C>G n/a
3 TRCN0000478887 AAACCCGTGACTCAATATTATTCC pLX_317 54.5% 99.8% 99.6% V5 752C>G n/a
Download CSV