Transcript: Human NM_170775.3

Homo sapiens potassium calcium-activated channel subfamily N member 2 (KCNN2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KCNN2 (3781)
Length:
1472
CDS:
463..1158

Additional Resources:

NCBI RefSeq record:
NM_170775.3
NBCI Gene record:
KCNN2 (3781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_170775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418185 TATGGTTCTAATCAGCGTTAT pLKO_005 1235 3UTR 100% 10.800 15.120 N KCNN2 n/a
2 TRCN0000434720 AGCTAGAAGAGAATAAGTTAA pLKO_005 1153 CDS 100% 13.200 9.240 N KCNN2 n/a
3 TRCN0000043844 CCAGAACATCATGTATGATAT pLKO.1 873 CDS 100% 13.200 9.240 N KCNN2 n/a
4 TRCN0000423006 GCGATGTGGTTGATATCAATA pLKO_005 460 5UTR 100% 13.200 9.240 N KCNN2 n/a
5 TRCN0000043847 CTGCCAATGTACTCAGGGAAA pLKO.1 686 CDS 100% 4.050 2.835 N KCNN2 n/a
6 TRCN0000069177 GAGACTTTGATTGGTAGCATT pLKO.1 961 CDS 100% 4.950 3.465 N Kcnn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00901 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00901 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480327 AAGGTTGAGGTGAGAACAGGAACC pLX_317 51.7% 100% 100% V5 n/a
Download CSV