Transcript: Human NM_001122764.3

Homo sapiens protoporphyrinogen oxidase (PPOX), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
PPOX (5498)
Length:
1733
CDS:
256..1689

Additional Resources:

NCBI RefSeq record:
NM_001122764.3
NBCI Gene record:
PPOX (5498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001122764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381709 GCCCTAATGGTGCTATCTTTG pLKO_005 398 CDS 100% 10.800 15.120 N PPOX n/a
2 TRCN0000045983 GACCACGTTATTAGTGCCATT pLKO.1 1093 CDS 100% 4.050 3.240 N PPOX n/a
3 TRCN0000045987 GCAAACCCATCGTTCCATATT pLKO.1 828 CDS 100% 13.200 9.240 N PPOX n/a
4 TRCN0000298237 GCAAACCCATCGTTCCATATT pLKO_005 828 CDS 100% 13.200 9.240 N PPOX n/a
5 TRCN0000293948 ACTAGAGTCAGCTAGGCAATT pLKO_005 1542 CDS 100% 10.800 7.560 N PPOX n/a
6 TRCN0000293905 GCGCTGGAAGGTATCTCTAAG pLKO_005 1053 CDS 100% 10.800 7.560 N PPOX n/a
7 TRCN0000045985 AGGCCCTAATGGTGCTATCTT pLKO.1 396 CDS 100% 5.625 3.938 N PPOX n/a
8 TRCN0000045984 CGTGTATGACTCAGTTGCTTT pLKO.1 1293 CDS 100% 4.950 3.465 N PPOX n/a
9 TRCN0000286469 CGTGTATGACTCAGTTGCTTT pLKO_005 1293 CDS 100% 4.950 3.465 N PPOX n/a
10 TRCN0000045986 CCATCTACACAAGAACTGCAT pLKO.1 1491 CDS 100% 2.640 1.848 N PPOX n/a
11 TRCN0000286537 CCATCTACACAAGAACTGCAT pLKO_005 1491 CDS 100% 2.640 1.848 N PPOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01257 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01257 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469068 ATATATTCTCGATTAGGTCAAACG pLX_317 33.7% 100% 100% V5 n/a
Download CSV