Construct: ORF TRCN0000469068
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017275.1_s317c1
- Derived from:
- ccsbBroadEn_01257
- DNA Barcode:
- ATATATTCTCGATTAGGTCAAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPOX (5498)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469068
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_000309.5 | 100% | 100% | |
2 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001122764.3 | 100% | 100% | |
3 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001365398.1 | 100% | 100% | |
4 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509671.1 | 92.6% | 92.6% | 1_114del |
5 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001365399.1 | 92.2% | 92.2% | 987_988ins111 |
6 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_006711404.4 | 91.7% | 91.7% | 1_114del;336_350del |
7 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001350128.2 | 90.7% | 90% | (many diffs) |
8 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_017001559.1 | 84.6% | 84.6% | 1_114del;336_350del;1116_1117ins111 |
9 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509672.3 | 84.1% | 83.4% | (many diffs) |
10 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_005245291.4 | 83.6% | 80.6% | (many diffs) |
11 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_006711403.2 | 83.6% | 80.6% | (many diffs) |
12 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_006711402.2 | 82.8% | 79.9% | (many diffs) |
13 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509667.2 | 82.8% | 79.9% | (many diffs) |
14 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509668.2 | 82.8% | 79.9% | (many diffs) |
15 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509665.2 | 80.8% | 78.8% | (many diffs) |
16 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509664.1 | 78.1% | 75.2% | (many diffs) |
17 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509663.2 | 77.4% | 74.6% | (many diffs) |
18 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_024447864.1 | 76.5% | 76.5% | 1_114del;335_336ins249 |
19 | human | 5498 | PPOX | protoporphyrinogen oxidase | XR_921850.2 | 71.8% | (many diffs) | |
20 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509666.2 | 71.1% | 68.1% | (many diffs) |
21 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509670.2 | 70.7% | 67% | (many diffs) |
22 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001350129.2 | 69.2% | 67% | 0_1ins427;43_61del |
23 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001365400.1 | 69.2% | 67% | 0_1ins427;43_61del |
24 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_017001566.2 | 69.2% | 67% | 0_1ins427;43_61del |
25 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_017001567.1 | 69.2% | 67% | 0_1ins427;43_61del |
26 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_024447867.1 | 69.2% | 67% | 0_1ins427;43_61del |
27 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001350130.2 | 66% | 66% | 0_1ins486 |
28 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001350131.2 | 66% | 66% | 0_1ins486 |
29 | human | 5498 | PPOX | protoporphyrinogen oxidase | NM_001365401.1 | 66% | 66% | 0_1ins486 |
30 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509673.2 | 63.8% | 60.6% | (many diffs) |
31 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509674.2 | 60.8% | 57.6% | (many diffs) |
32 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_005245295.3 | 56.6% | 51.1% | (many diffs) |
33 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_006711406.2 | 56.6% | 51.1% | (many diffs) |
34 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509678.1 | 56.6% | 51.1% | (many diffs) |
35 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509679.1 | 56.6% | 51.1% | (many diffs) |
36 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_017001562.1 | 56.6% | 51.1% | (many diffs) |
37 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_024447865.1 | 56.6% | 51.1% | (many diffs) |
38 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_024447866.1 | 56.6% | 51.1% | (many diffs) |
39 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509681.1 | 53.6% | 50% | (many diffs) |
40 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_017001563.2 | 53.6% | 50% | (many diffs) |
41 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_017001564.1 | 53.6% | 50% | (many diffs) |
42 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_011509682.1 | 40.3% | 36.3% | (many diffs) |
43 | human | 5498 | PPOX | protoporphyrinogen oxidase | XM_017001570.1 | 40.3% | 36.3% | (many diffs) |
44 | mouse | 19044 | Ppox | protoporphyrinogen oxidase | NM_008911.2 | 85.2% | 88.6% | (many diffs) |
45 | mouse | 19044 | Ppox | protoporphyrinogen oxidase | XM_006496707.3 | 85.2% | 88.6% | (many diffs) |
46 | mouse | 19044 | Ppox | protoporphyrinogen oxidase | XM_011238772.2 | 76.3% | 76.5% | (many diffs) |
47 | mouse | 19044 | Ppox | protoporphyrinogen oxidase | XM_011238773.2 | 76.3% | 76.5% | (many diffs) |
48 | mouse | 19044 | Ppox | protoporphyrinogen oxidase | XM_006496709.3 | 69.6% | 72.3% | (many diffs) |
49 | mouse | 19044 | Ppox | protoporphyrinogen oxidase | XM_011238775.2 | 56.2% | 57.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1497
- ORF length:
- 1431
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ccggaccgtg gtcgtgctgg gcggaggcat cagcggcttg gccgccagtt 121 accacctgag ccgggccccc tgccccccta aggtggtcct agtggagagc agtgagcgtc 181 tgggaggctg gattcgctcc gttcgaggcc ctaatggtgc tatctttgag cttggacctc 241 ggggaattag gccagcggga gccctagggg cccggacctt gctcctggtt tctgagcttg 301 gcttggattc agaagtgctg cctgtccggg gagaccaccc agctgcccag aacaggttcc 361 tctacgtggg cggtgccctg catgccctac ccactggcct cagggggcta ctccgccctt 421 cacccccctt ctccaaacct ctgttttggg ctgggctgag ggagctgacc aagccccggg 481 gcaaagagcc tgatgagact gtgcacagtt ttgcccagcg ccgccttgga cctgaggtgg 541 cgtctctagc catggacagt ctctgccgtg gagtgtttgc aggcaacagc cgtgagctca 601 gcatcaggtc ctgctttccc agtctcttcc aagctgagca aacccatcgt tccatattac 661 tgggcctgct gctgggggca gggcggaccc cacagccaga ctcagcactc attcgccagg 721 ccttggctga gcgctggagc cagtggtcac ttcgtggagg tctagagatg ttgcctcagg 781 cccttgaaac ccacctgact agtagggggg tcagtgttct cagaggccag ccggtctgtg 841 ggctcagcct ccaggcagaa gggcgctgga aggtatctct aagggacagc agtctggagg 901 ctgaccacgt tattagtgcc attccagctt cagtgctcag tgagctgctc cctgctgagg 961 ctgcccctct ggctcgtgcc ctgagtgcca tcactgcagt gtctgtagct gtggtgaaTC 1021 TGCAGTACCA AGGAGCCCAT CTGCCTGTCC AGGGATTTGG ACATTTGGTG CCATCTTCAG 1081 AAGATCCAGG AGTCCTGGGA ATCGTGTATG ACTCAGTTGC TTTCCCTGAG CAGGACGGGA 1141 GCCCCCCTGG CCTCAGAGTG ACTGTGATGC TGGGAGGTTC CTGGTTACAG ACACTGGAGG 1201 CTAGTGGCTG TGTCTTATCT CAGGAGCTGT TTCAACAGCG GGCCCAGGAA GCAGCTGCTA 1261 CACAATTAGG ACTGAAGGAG ATGCCGAGCC ACTGCTTGGT CCATCTACAC AAGAACTGCA 1321 TTCCCCAGTA TACACTAGGT CACTGGCAAA AACTAGAGTC AGCTAGGCAA TTCCTGACTG 1381 CTCACAGGTT GCCCCTGACT CTGGCTGGAG CCTCCTATGA GGGAGTTGCT GTTAATGACT 1441 GTATAGAGAG TGGGCGCCAG GCAGCAGTCA GTGTCCTGGG CACAGAACCT AACAGCTGCC 1501 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1561 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1621 ATATATCTTG TGGAAAGGAC GAATATATTC TCGATTAGGT CAAACGACGC GTTAAGTCga 1681 caatcaacct ctggattaca aaatttgtga aagatt