Transcript: Human NM_020210.4

Homo sapiens semaphorin 4B (SEMA4B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SEMA4B (10509)
Length:
3833
CDS:
284..2797

Additional Resources:

NCBI RefSeq record:
NM_020210.4
NBCI Gene record:
SEMA4B (10509)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020210.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425318 TGGTGATGTGCACGCTCTTTG pLKO_005 2439 CDS 100% 10.800 15.120 N SEMA4B n/a
2 TRCN0000061194 CGATGATGACAAGATCTACTT pLKO.1 1048 CDS 100% 4.950 6.930 N SEMA4B n/a
3 TRCN0000428195 CTCTTCACCTTCCACATTATC pLKO_005 3231 3UTR 100% 13.200 9.240 N SEMA4B n/a
4 TRCN0000412644 GAACAGTGCTCCTTATGTAAA pLKO_005 3041 3UTR 100% 13.200 9.240 N SEMA4B n/a
5 TRCN0000418218 GTGGCAGTGTACCCGTCATTA pLKO_005 2340 CDS 100% 13.200 9.240 N SEMA4B n/a
6 TRCN0000061196 CATGTGTACCTACATCAACAT pLKO.1 751 CDS 100% 4.950 3.465 N SEMA4B n/a
7 TRCN0000061193 CGAAGCTGAACACATCTCCAA pLKO.1 469 CDS 100% 2.640 1.848 N SEMA4B n/a
8 TRCN0000061195 CGGCACCGGAACAGCATGAAA pLKO.1 2498 CDS 100% 1.875 1.313 N SEMA4B n/a
9 TRCN0000061197 CCGCGTGCTGAACTTCCTCAA pLKO.1 1534 CDS 100% 1.350 0.945 N SEMA4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020210.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07623 pDONR223 100% 99.8% 99.8% None 1588A>C;2181G>A;2389T>G n/a
2 ccsbBroad304_07623 pLX_304 0% 99.8% 99.8% V5 1588A>C;2181G>A;2389T>G n/a
3 TRCN0000474968 TACTTTAACCTTTAACACATGCCG pLX_317 22.2% 99.8% 99.8% V5 1588A>C;2181G>A;2389T>G n/a
4 ccsbBroadEn_07624 pDONR223 100% 99.7% 99.6% None (many diffs) n/a
5 ccsbBroad304_07624 pLX_304 0% 99.7% 99.6% V5 (many diffs) n/a
6 TRCN0000479465 CTCCAGCCTCCAGTGACGGGTATG pLX_317 11% 99.7% 99.6% V5 (many diffs) n/a
7 ccsbBroadEn_15716 pDONR223 0% 56.5% 56.5% None (many diffs) n/a
8 ccsbBroad304_15716 pLX_304 0% 56.5% 56.5% V5 (many diffs) n/a
9 TRCN0000473456 TCGTGGGCCTAATGTCCACTAGTG pLX_317 22% 56.5% 56.5% V5 (many diffs) n/a
Download CSV